ID: 1061067158

View in Genome Browser
Species Human (GRCh38)
Location 9:128285710-128285732
Sequence CAACCCCACCCTAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061067151_1061067158 18 Left 1061067151 9:128285669-128285691 CCTCAGCTGTGGCCAGGGTCACA 0: 1
1: 0
2: 1
3: 31
4: 291
Right 1061067158 9:128285710-128285732 CAACCCCACCCTAAGGAGACAGG No data
1061067156_1061067158 -10 Left 1061067156 9:128285697-128285719 CCACTGTGGCTGGCAACCCCACC 0: 1
1: 0
2: 1
3: 25
4: 314
Right 1061067158 9:128285710-128285732 CAACCCCACCCTAAGGAGACAGG No data
1061067153_1061067158 6 Left 1061067153 9:128285681-128285703 CCAGGGTCACATGGTACCACTGT 0: 1
1: 0
2: 3
3: 26
4: 238
Right 1061067158 9:128285710-128285732 CAACCCCACCCTAAGGAGACAGG No data
1061067150_1061067158 19 Left 1061067150 9:128285668-128285690 CCCTCAGCTGTGGCCAGGGTCAC 0: 1
1: 0
2: 2
3: 29
4: 347
Right 1061067158 9:128285710-128285732 CAACCCCACCCTAAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061067158 Original CRISPR CAACCCCACCCTAAGGAGAC AGG Intronic
No off target data available for this crispr