ID: 1061068198

View in Genome Browser
Species Human (GRCh38)
Location 9:128292288-128292310
Sequence GCCACCAGAGTGACCACAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061068195_1061068198 10 Left 1061068195 9:128292255-128292277 CCTCTATTTTGAGCTATACCATC No data
Right 1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG No data
1061068194_1061068198 13 Left 1061068194 9:128292252-128292274 CCTCCTCTATTTTGAGCTATACC No data
Right 1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG No data
1061068197_1061068198 -8 Left 1061068197 9:128292273-128292295 CCATCAGAACATGTGGCCACCAG No data
Right 1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG No data
1061068193_1061068198 14 Left 1061068193 9:128292251-128292273 CCCTCCTCTATTTTGAGCTATAC No data
Right 1061068198 9:128292288-128292310 GCCACCAGAGTGACCACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061068198 Original CRISPR GCCACCAGAGTGACCACAGC AGG Intergenic
No off target data available for this crispr