ID: 1061071173

View in Genome Browser
Species Human (GRCh38)
Location 9:128311578-128311600
Sequence CCACGTGACCAGAGAGAAGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061071173_1061071179 -6 Left 1061071173 9:128311578-128311600 CCAGCTTCTCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1061071179 9:128311595-128311617 ACGTGGTCTGGAAAAGGCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 183
1061071173_1061071180 -5 Left 1061071173 9:128311578-128311600 CCAGCTTCTCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1061071180 9:128311596-128311618 CGTGGTCTGGAAAAGGCAGGGGG 0: 1
1: 0
2: 1
3: 23
4: 269
1061071173_1061071178 -7 Left 1061071173 9:128311578-128311600 CCAGCTTCTCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1061071178 9:128311594-128311616 CACGTGGTCTGGAAAAGGCAGGG 0: 1
1: 0
2: 1
3: 15
4: 161
1061071173_1061071182 27 Left 1061071173 9:128311578-128311600 CCAGCTTCTCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1061071182 9:128311628-128311650 TACAGGTACCTGCTGAGTATTGG 0: 1
1: 0
2: 0
3: 7
4: 86
1061071173_1061071181 10 Left 1061071173 9:128311578-128311600 CCAGCTTCTCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1061071181 9:128311611-128311633 GCAGGGGGTTGTCAATGTACAGG 0: 1
1: 1
2: 3
3: 15
4: 73
1061071173_1061071177 -8 Left 1061071173 9:128311578-128311600 CCAGCTTCTCTCTGGTCACGTGG 0: 1
1: 0
2: 0
3: 10
4: 159
Right 1061071177 9:128311593-128311615 TCACGTGGTCTGGAAAAGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061071173 Original CRISPR CCACGTGACCAGAGAGAAGC TGG (reversed) Exonic
900080920 1:856779-856801 CCACCTGACCTGAGAGTGGCGGG - Intergenic
900531670 1:3156862-3156884 CCGTGTGGCCTGAGAGAAGCAGG + Intronic
903659126 1:24966179-24966201 CCACATGACCTTAGACAAGCTGG - Intergenic
903682064 1:25103703-25103725 CCCCGTGAGCAGAGAGCAGCTGG - Intergenic
904261422 1:29289827-29289849 CGAGGTGACCAGAGAGAACCGGG - Intronic
904386924 1:30148930-30148952 GCAAGTGACCTGAGAGATGCAGG - Intergenic
906496085 1:46304912-46304934 CCAAGTGACCAGAGAACAGACGG - Intronic
906588164 1:46999151-46999173 CCAGGTGAACAGAGAAGAGCTGG - Intergenic
908499610 1:64730064-64730086 CCTTGTGTCCAGAGACAAGCAGG - Intergenic
909287626 1:73839532-73839554 CTAGTTTACCAGAGAGAAGCAGG + Intergenic
918658267 1:187056079-187056101 AATCTTGACCAGAGAGAAGCTGG - Intergenic
921256942 1:213350212-213350234 ACATGTGACCTGAGAGACGCAGG - Intergenic
923437052 1:233977182-233977204 ACACAAGCCCAGAGAGAAGCAGG - Intronic
1064033111 10:11895237-11895259 CCCCATGACCAGCGAGAGGCGGG + Intergenic
1067048128 10:42997357-42997379 ACATGTGATCAGAGGGAAGCTGG - Intergenic
1074302719 10:112247624-112247646 TCTCTTGACCAGGGAGAAGCAGG + Intergenic
1075060982 10:119256529-119256551 CCATGTACCCAGAGAGCAGCAGG - Intronic
1075423885 10:122327005-122327027 CCACTGGACCAGAGAGGAGCAGG + Intronic
1076528135 10:131125695-131125717 CCACGTGAGCAGAGCAGAGCTGG - Intronic
1077128735 11:958208-958230 CCACGTGAGCACACAGAAGGTGG + Intronic
1077209811 11:1364685-1364707 CCACGTGAGGAGTGGGAAGCAGG - Intergenic
1077339979 11:2021923-2021945 CCCCGTGGCGAGAGAGAACCTGG + Intergenic
1089183889 11:116601864-116601886 CTCTGTGACCATAGAGAAGCTGG + Intergenic
1089706692 11:120283308-120283330 CCACGTGACCTGGGAGAGACAGG + Intronic
1089909582 11:122083385-122083407 CCAGGTTAACAGAGAGGAGCAGG - Intergenic
1091255051 11:134176383-134176405 CCTCCTGTGCAGAGAGAAGCCGG + Exonic
1091340312 11:134806930-134806952 CCACCTTCCCAGAGAGCAGCTGG - Intergenic
1202822964 11_KI270721v1_random:77112-77134 CCCCGTGGCGAGAGAGAACCTGG + Intergenic
1092097628 12:5856691-5856713 CAAAGTGTCAAGAGAGAAGCTGG + Intronic
1092679180 12:10958398-10958420 CTATGTGAACAGAGAGAAGGAGG + Intronic
1092751079 12:11719751-11719773 GCAAGGGACAAGAGAGAAGCGGG + Intronic
1096599317 12:52718231-52718253 CCACATGACCAAAGTGGAGCTGG - Intergenic
1097234044 12:57527909-57527931 CCAACTGGCCAGAGAGAAGAGGG - Exonic
1104934677 12:132358106-132358128 CCACGTGGCCACAGAGATGACGG + Intergenic
1105760712 13:23511910-23511932 CCACTTGACAAGAGAGAATGTGG + Intergenic
1106340826 13:28824987-28825009 CCACCTGACCAGAGTGCAGCTGG + Intronic
1106483516 13:30154304-30154326 CCACTGGACGAGAGAGAATCTGG - Intergenic
1106838344 13:33660107-33660129 CCTCGTGAGCAGAGCGTAGCTGG - Intergenic
1108935394 13:55875403-55875425 CCAGTTTACCAGAGAGAAGAAGG - Intergenic
1113867792 13:113539343-113539365 CTCCGTGACCTGAGAGAGGCAGG - Exonic
1119308075 14:73623853-73623875 TCACATGGCGAGAGAGAAGCAGG - Intergenic
1121585857 14:95062395-95062417 GCACGTGCCCACCGAGAAGCAGG - Intergenic
1124089065 15:26580453-26580475 CCATCTGCCAAGAGAGAAGCAGG + Exonic
1127386739 15:58473217-58473239 TTATGTGACCAGAGAGAAGCAGG + Intronic
1129348291 15:74938230-74938252 TCACCTGACCAGAGACAAGGCGG - Intergenic
1129359275 15:75014295-75014317 CCATGTAACCTGAGAGAAGGGGG + Intronic
1130167749 15:81480947-81480969 CCAAGAGCCCAGAGAGAGGCGGG + Intergenic
1132498080 16:273244-273266 CCTTGGGCCCAGAGAGAAGCTGG + Intronic
1132623564 16:879524-879546 CCCCGTGTCCACAGAGACGCTGG - Intronic
1132775166 16:1589539-1589561 CAACGAGGCCAGAGAGAACCTGG + Intronic
1136170765 16:28487797-28487819 CCACGTGGCCAAGGAGAGGCAGG + Intronic
1139003581 16:62543763-62543785 CCAGATGACCAGAGTGAGGCTGG - Intergenic
1140481366 16:75264679-75264701 GCAGATGACCAGAGGGAAGCTGG - Intronic
1140739470 16:77928233-77928255 CCTGGTGACCAGAGAGATGTTGG - Intronic
1141849481 16:86635453-86635475 CCTGGTAACCAGAGAAAAGCAGG + Intergenic
1142190309 16:88714377-88714399 CCACAGGACAAGTGAGAAGCTGG + Exonic
1142597660 17:1037353-1037375 TGACGTGGCCAGAGAGAGGCTGG - Intronic
1143779355 17:9221283-9221305 CCACGTGACCAGCGAGGTGCTGG + Intronic
1144587218 17:16494378-16494400 CCAGGTGACCAGAGATCACCTGG + Intergenic
1145868385 17:28255264-28255286 CCAGGTTCCCAGAGAGCAGCAGG + Intergenic
1146646293 17:34579449-34579471 CCACGTGACCACGGGGAATCTGG + Intergenic
1147879304 17:43643634-43643656 CCAGGAGAACAGAGGGAAGCCGG - Exonic
1147879853 17:43646375-43646397 CCACGGGCCCGGAGAGAGGCAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151588116 17:75023645-75023667 CCACATGACCAAATAGAAACTGG - Intergenic
1153536525 18:6107937-6107959 CCAAGTGACAAGTGAGAAACAGG + Intronic
1153820640 18:8828657-8828679 CCATCTGCCCAGAGAGAAGAAGG - Intronic
1153926455 18:9839228-9839250 CCACCTGAACAGGGAGAAGTGGG + Intronic
1154046960 18:10915241-10915263 TCACGTGTGCAGAGGGAAGCAGG + Intronic
1154174702 18:12077787-12077809 TCACGTGTGCAGAGGGAAGCAGG - Intergenic
1155213168 18:23620023-23620045 CCACAAACCCAGAGAGAAGCCGG + Intronic
1155589546 18:27410825-27410847 CCAGGTGCCCAGAGATAAACAGG + Intergenic
1157959586 18:52137915-52137937 CCAGTTTACCAGAGAGAATCAGG - Intergenic
1159665214 18:71150420-71150442 CCACTTTAACAGAGAGAAACAGG + Intergenic
1161702024 19:5800834-5800856 CCACGTGGGCAGAGAGCAGGTGG + Intergenic
1163700625 19:18784968-18784990 CCACATGACCACGTAGAAGCTGG + Exonic
1164814136 19:31181408-31181430 CCATCTGAGCAGAGAGAAGAAGG + Intergenic
1164984039 19:32635172-32635194 CCAGGTGACCAGAGACACCCTGG + Intronic
1165376704 19:35448194-35448216 CCACGTGACCAGAGAAAGGAAGG - Intronic
1166602724 19:44112217-44112239 CCACGTGCACAGTAAGAAGCTGG - Intronic
1166976924 19:46610240-46610262 CCAAGTCACCACGGAGAAGCGGG - Exonic
1167612031 19:50512341-50512363 CCAGGTGAGCAGAGCTAAGCAGG - Exonic
929410612 2:41694524-41694546 CCACATCACTACAGAGAAGCGGG - Intergenic
931987931 2:67758968-67758990 CTACCTGAACAGAGAGAAGGAGG + Intergenic
934541053 2:95175424-95175446 CCACGGGACCAGAGGCAGGCAGG - Intronic
936105819 2:109623584-109623606 CCACCTGACCACACAGAAACTGG - Intergenic
936343843 2:111660202-111660224 GCATGTGATCAGGGAGAAGCTGG - Intergenic
936444955 2:112587917-112587939 CAAGGAGACCAGAGAGAGGCTGG - Intronic
937047547 2:118859613-118859635 GCAGGTGTGCAGAGAGAAGCGGG + Intergenic
940259619 2:151766334-151766356 CCACATGACCAGGGAGCAGTGGG + Intergenic
944508273 2:200438114-200438136 CCATGGGAGTAGAGAGAAGCAGG + Intronic
944882446 2:204027179-204027201 CCATGGGAACAGAGATAAGCAGG - Intergenic
945936477 2:215907468-215907490 CCACGTGTACAGTAAGAAGCAGG - Intergenic
946306748 2:218860552-218860574 TCAGGAGCCCAGAGAGAAGCCGG - Intronic
946876830 2:224137962-224137984 CCTCATGACCAGGGAGAAGGGGG - Intergenic
947741768 2:232487938-232487960 CCAGGTGGCCCGAGAGATGCAGG - Intergenic
948265037 2:236629734-236629756 CCACGTGATGAGGGAGAGGCTGG - Intergenic
1168771391 20:419197-419219 CCACTTGGCCAGATGGAAGCTGG + Intronic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1169165841 20:3423321-3423343 CTACCTGACAAGTGAGAAGCTGG - Intergenic
1169848368 20:10021727-10021749 CAAAGTGACTAAAGAGAAGCAGG + Intronic
1172278687 20:33695254-33695276 CCACCTGACCACATAGCAGCGGG - Intergenic
1172755455 20:37280602-37280624 GCACCTGACTAGACAGAAGCAGG + Intergenic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175197909 20:57258141-57258163 ACACGTGACCTCAGAGATGCAGG + Intronic
1175459001 20:59136802-59136824 CCACGTGCCCAGATAAAACCTGG - Intergenic
1176045282 20:63089496-63089518 GCAGGTGACCAGACAGAGGCTGG + Intergenic
1177856341 21:26404602-26404624 CCCAGTGAGCAGAGAGCAGCAGG - Intergenic
1177940414 21:27403337-27403359 CCAAGAGACCAGAGACATGCAGG - Intergenic
1179278798 21:39916158-39916180 CCATGTGCTCAGAGAGAAGAAGG + Intronic
949783047 3:7711468-7711490 CCACTGGTCCAGTGAGAAGCTGG + Intronic
950796082 3:15511748-15511770 CCAGATGACCACAGAGAATCTGG + Intronic
954412413 3:50376574-50376596 CCACGTCAAGAGAGAGCAGCGGG + Intronic
955814903 3:62831976-62831998 CATCTTGACCAGAGGGAAGCTGG - Intronic
956230033 3:67003928-67003950 CCAAATGACCTGAGAGAAGTTGG + Exonic
960498541 3:118406859-118406881 CTAGGGGACCAGAGAGATGCTGG + Intergenic
960846085 3:122005713-122005735 CCATGGGAGCAGAGAGAGGCTGG - Intronic
961816047 3:129550943-129550965 CCAGGGGACCAGAGAGAAGGTGG - Intronic
962680153 3:137790905-137790927 CCAGGTGAGAAGGGAGAAGCAGG + Intergenic
962888799 3:139652897-139652919 AAAAGTGACCAGAGAAAAGCAGG + Intronic
963893161 3:150658443-150658465 CCACGTGTACAGTAAGAAGCAGG + Intergenic
965927112 3:173995280-173995302 GCAGGTGGACAGAGAGAAGCAGG - Intronic
968605411 4:1532917-1532939 CCACGTGCCCACACAGACGCAGG + Intergenic
970806826 4:20046325-20046347 CGACATCACCAGCGAGAAGCAGG + Intergenic
971102743 4:23485895-23485917 CCACTTGGCCAGAAGGAAGCAGG - Intergenic
982379969 4:154739897-154739919 CCTCGTGACATGAGAGAAGAGGG + Intronic
990440300 5:55837834-55837856 CCTCGTGAACTGACAGAAGCTGG - Intergenic
992774686 5:80079164-80079186 CCACATGACCACGTAGAAGCTGG - Exonic
996365940 5:122701599-122701621 CCACGTGTCCAGGGAGAAACAGG - Intergenic
999379589 5:151110767-151110789 CCAAGAGACCTGAGAGAACCCGG + Intronic
1002758895 6:186610-186632 CAACATGACCAGTTAGAAGCAGG - Intergenic
1002951682 6:1818978-1819000 CCGCATGACTAGATAGAAGCTGG + Intronic
1003333994 6:5153455-5153477 CCAGCTGGGCAGAGAGAAGCTGG + Intronic
1005006677 6:21294315-21294337 CCACGTGTACAGTAAGAAGCAGG + Intergenic
1005753224 6:28903038-28903060 GCACGTACCCACAGAGAAGCAGG + Exonic
1012961375 6:105625552-105625574 CAAAGTGACCAATGAGAAGCAGG + Intergenic
1014913610 6:127119980-127120002 ACATGTGACAAGAGAGAACCTGG - Intronic
1019698218 7:2459813-2459835 GCACGTCTCCAAAGAGAAGCTGG + Intergenic
1019998934 7:4743752-4743774 CCTCAGGTCCAGAGAGAAGCAGG + Intronic
1020917038 7:14207467-14207489 ACACCTCACCACAGAGAAGCTGG - Intronic
1024232255 7:47371489-47371511 CCACCTGCCCAGAGAGCACCAGG + Intronic
1025950555 7:66142077-66142099 CCACGTGAAGAGGGAGAAGAGGG - Intronic
1035524348 8:300683-300705 CCACCTGACCTGAGAGTGGCGGG + Intergenic
1035582709 8:749923-749945 CCACGTGGAGACAGAGAAGCAGG - Intergenic
1038544147 8:28412431-28412453 CCACGCGCCCAAAGAAAAGCGGG - Intronic
1041120251 8:54579427-54579449 CAACGTGACAAGAGAGGAGTTGG - Intergenic
1045039060 8:98203572-98203594 CCACGTGCCAAGAAAGAAGATGG + Intronic
1045214735 8:100136671-100136693 CCAGGTGAACACAGAGAAGAGGG - Intronic
1047029744 8:120863265-120863287 CCACGTGTCATGAGAGAAACCGG - Intergenic
1047436484 8:124839327-124839349 CCAGGTGCCCAGGGAGAGGCAGG - Intergenic
1048352365 8:133626492-133626514 CCACGTGGCCAGAGGGGAGTAGG + Intergenic
1049006602 8:139859647-139859669 CCAGACGGCCAGAGAGAAGCTGG + Intronic
1052886277 9:33651221-33651243 CCACGTGGGCAGAGAGAAATGGG + Intergenic
1055871547 9:80886555-80886577 CAAGGTAACCAGAGAGAACCTGG + Intergenic
1056533785 9:87510223-87510245 CCTCGTGGCCATGGAGAAGCAGG + Intronic
1056722267 9:89082305-89082327 CCATGTCACCAGCAAGAAGCTGG - Intronic
1057548254 9:96034025-96034047 CCCAGTGACCGGAGAGCAGCGGG - Intergenic
1058164844 9:101607546-101607568 CCCCGTGAGCAGGGAGAAGGAGG + Intronic
1058850985 9:109012676-109012698 CCACGAGGCCGGACAGAAGCGGG + Intronic
1059262383 9:112990691-112990713 CCACGGGTACAAAGAGAAGCTGG - Intergenic
1059415765 9:114161684-114161706 GCACGTGGCCAGAGACAGGCGGG - Intronic
1060452584 9:123756928-123756950 CCACATGAGCAGAGAGAGACAGG + Intronic
1060738770 9:126083890-126083912 CCAAGTGGCCAGAAAGAAGAAGG - Intergenic
1061071173 9:128311578-128311600 CCACGTGACCAGAGAGAAGCTGG - Exonic
1061518011 9:131100763-131100785 CCACAGGGACAGAGAGAAGCAGG + Intronic
1062413094 9:136434528-136434550 CCACGTGGCCAGGGAGGTGCAGG + Intronic
1185793471 X:2945250-2945272 CCACGTGGCCAGAATGCAGCAGG + Intronic
1194768294 X:97868995-97869017 CCAAGACACCAGTGAGAAGCAGG + Intergenic
1198160010 X:133998919-133998941 CCACTTTTCCTGAGAGAAGCTGG - Intergenic
1200788403 Y:7278630-7278652 AGACGTCACCAAAGAGAAGCTGG - Intergenic