ID: 1061072990

View in Genome Browser
Species Human (GRCh38)
Location 9:128323101-128323123
Sequence GGCCGCCGGCTCCGCGGCGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 6, 3: 18, 4: 150}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061072977_1061072990 10 Left 1061072977 9:128323068-128323090 CCTCCCCACCTCCCCGCTGCAGA 0: 1
1: 0
2: 7
3: 107
4: 693
Right 1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG 0: 1
1: 0
2: 6
3: 18
4: 150
1061072978_1061072990 7 Left 1061072978 9:128323071-128323093 CCCCACCTCCCCGCTGCAGAAAG 0: 1
1: 0
2: 1
3: 58
4: 350
Right 1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG 0: 1
1: 0
2: 6
3: 18
4: 150
1061072985_1061072990 -2 Left 1061072985 9:128323080-128323102 CCCGCTGCAGAAAGGGCTGTTGG 0: 1
1: 3
2: 3
3: 21
4: 265
Right 1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG 0: 1
1: 0
2: 6
3: 18
4: 150
1061072981_1061072990 5 Left 1061072981 9:128323073-128323095 CCACCTCCCCGCTGCAGAAAGGG 0: 1
1: 0
2: 0
3: 42
4: 254
Right 1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG 0: 1
1: 0
2: 6
3: 18
4: 150
1061072974_1061072990 28 Left 1061072974 9:128323050-128323072 CCCGCTATACTCGCACCACCTCC 0: 1
1: 0
2: 1
3: 9
4: 103
Right 1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG 0: 1
1: 0
2: 6
3: 18
4: 150
1061072976_1061072990 13 Left 1061072976 9:128323065-128323087 CCACCTCCCCACCTCCCCGCTGC 0: 1
1: 0
2: 45
3: 321
4: 2315
Right 1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG 0: 1
1: 0
2: 6
3: 18
4: 150
1061072979_1061072990 6 Left 1061072979 9:128323072-128323094 CCCACCTCCCCGCTGCAGAAAGG 0: 1
1: 0
2: 2
3: 26
4: 203
Right 1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG 0: 1
1: 0
2: 6
3: 18
4: 150
1061072984_1061072990 -1 Left 1061072984 9:128323079-128323101 CCCCGCTGCAGAAAGGGCTGTTG 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG 0: 1
1: 0
2: 6
3: 18
4: 150
1061072983_1061072990 2 Left 1061072983 9:128323076-128323098 CCTCCCCGCTGCAGAAAGGGCTG 0: 1
1: 0
2: 2
3: 17
4: 186
Right 1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG 0: 1
1: 0
2: 6
3: 18
4: 150
1061072975_1061072990 27 Left 1061072975 9:128323051-128323073 CCGCTATACTCGCACCACCTCCC 0: 1
1: 0
2: 0
3: 10
4: 216
Right 1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG 0: 1
1: 0
2: 6
3: 18
4: 150
1061072987_1061072990 -3 Left 1061072987 9:128323081-128323103 CCGCTGCAGAAAGGGCTGTTGGC 0: 1
1: 0
2: 5
3: 20
4: 186
Right 1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG 0: 1
1: 0
2: 6
3: 18
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061072990 Original CRISPR GGCCGCCGGCTCCGCGGCGA TGG Exonic
901673102 1:10867301-10867323 GGCCGCGGGCGGCGCGGGGACGG + Intergenic
902920692 1:19664834-19664856 GGGCGCACGCTCCGCGGCGCGGG + Intergenic
903504720 1:23825325-23825347 GGCCGCCGCCTCGGCGGCTCGGG + Intronic
904031649 1:27536952-27536974 GGCCGCAGGCACCGCGGGAATGG - Intronic
904128824 1:28260530-28260552 GGCCGCCCGGTACGCGGCGGCGG + Intronic
904973942 1:34441719-34441741 GGCCGGCGGCTCCGCAGGGGAGG + Intergenic
905145282 1:35883242-35883264 TGCTGCAGGCTCCGCGGCGGCGG + Exonic
905752363 1:40477259-40477281 GGCCGCCGGCTCCGCCCACAGGG - Exonic
907053509 1:51345080-51345102 GGCCGCCGCCGCCGCCGCGAGGG - Exonic
908523394 1:64966129-64966151 GCCCGCCGGCTCCGCGGGGCTGG + Intronic
908561292 1:65309456-65309478 GCCGGGCGGCTCCGCGGCGTTGG + Intronic
908796247 1:67833447-67833469 GGGCGCCGGCTCCGCCTCGCTGG + Exonic
910876779 1:91885785-91885807 GGCAGCCCGCGCCGCGCCGACGG + Intronic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
914803218 1:150974923-150974945 GGCCTCCCGCGCCGGGGCGAAGG - Exonic
915128090 1:153679519-153679541 GACCGCCGGCGCCCCGGCGCTGG + Exonic
919826506 1:201507072-201507094 GGCAGCTGGCTCGGCGGCGCAGG + Exonic
921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG + Exonic
922239970 1:223749043-223749065 GGCCTCCGAGTCCGCGGCGCTGG - Exonic
922696835 1:227735160-227735182 GGCGCCCGGCTCCGAGACGAAGG + Exonic
924502884 1:244653253-244653275 GGCCTCCGGCCCCGCGGAGACGG + Exonic
1062774638 10:135341-135363 CGCCGCCGGCTCCGCGCGAAGGG - Intronic
1063429618 10:5977400-5977422 GGCCGCCGGCGACGCGGGGTAGG - Exonic
1066429345 10:35336888-35336910 GGCCGCCGGGTCAGCAGCGGCGG - Exonic
1068967177 10:62924470-62924492 GGCCTCCGGCTCCACGGAGCAGG - Intergenic
1070179232 10:73998335-73998357 GGCCGCCTGCACGGCGGCCACGG - Exonic
1070290667 10:75111520-75111542 GGCCGCCGTCACCGCCGCGCCGG - Intronic
1071579571 10:86756870-86756892 GCCCACCCGCTCCGCGCCGAGGG + Exonic
1072059819 10:91798743-91798765 GGCGGCCGGCTCCACGGCCTCGG - Exonic
1074182882 10:111078754-111078776 GCCCCCCGGCGGCGCGGCGACGG - Exonic
1075438571 10:122462099-122462121 GGCCGCAGGCTCCGCGCTGCAGG - Exonic
1075748490 10:124744235-124744257 GTCTGGCGGCTCCGCGGCGGCGG - Intronic
1076668240 10:132104858-132104880 GGCCGCCTGCAGCGCCGCGAGGG - Exonic
1078246218 11:9574535-9574557 GGCGGCCGGGGCCGCGGCGCCGG + Intronic
1078334228 11:10451079-10451101 GGCCGCAGGGTCCGCGGGGCTGG - Intronic
1080628522 11:34052171-34052193 AGCCGGCGGCTCCGCGGGGGAGG + Intronic
1081492584 11:43579622-43579644 GCCCGCCGCCGCCGCGGCGCGGG - Intronic
1083289177 11:61680390-61680412 GGGCGCCGGCGCCGGCGCGAAGG - Intergenic
1083813230 11:65117126-65117148 GGCCGCGGGCTCCGCGGCGGAGG + Exonic
1083965794 11:66042953-66042975 GGCCGCCATCCCCGCGGCGCTGG - Exonic
1084102386 11:66958240-66958262 GTGCGCCGGCACCGCTGCGAGGG - Intronic
1084165384 11:67372867-67372889 TGCCGCCGGCTCCCCGGCCGTGG + Intronic
1085208106 11:74749189-74749211 GGCCGCGGGCGCGGCAGCGAGGG - Exonic
1089835025 11:121363060-121363082 GCCCACCCGCTCCGCGCCGAGGG - Intergenic
1091603450 12:1931332-1931354 TGCCACCAGCTCCGCGGGGATGG - Intergenic
1095206107 12:39442677-39442699 GGCTGGCGGCTGCGCGGCGCCGG - Intronic
1095261597 12:40105313-40105335 CACCGCCGGCTCCGCGGTGCTGG - Exonic
1095349144 12:41188780-41188802 GCCCGCCGGCTCCGCAGCCGCGG + Exonic
1096983733 12:55743388-55743410 GGCCGAGGGCCCCGCGGCGGCGG + Exonic
1103563597 12:121804674-121804696 GGCCGCCGCCGCCGCCGCGGCGG + Intronic
1107467845 13:40665936-40665958 GGCGCCCGGCTCCGTGGCGGCGG - Exonic
1110558390 13:76885714-76885736 GGCCGCCGCCCTCGCGGCGCGGG - Exonic
1113494150 13:110714383-110714405 AGCGGCCGGCTCCGCAGCGGCGG + Intronic
1113654206 13:112057938-112057960 AGCGGGCGGCTCCGCGGCGCTGG - Intergenic
1113775602 13:112943386-112943408 GGTCCCCGGCTCCGCGCCGCAGG + Intronic
1119219371 14:72893602-72893624 GGCCGCGGGCTCGGGGGCGCGGG + Intronic
1119410314 14:74426161-74426183 GGCCGAGGGCTGCGCGGCGGCGG - Intergenic
1119520155 14:75279138-75279160 AGCCCCCGGCCCCGCGGCGACGG - Intronic
1120834442 14:89027387-89027409 GCTCTCCGGCTCCGCGGCGCGGG + Intergenic
1122081488 14:99270623-99270645 GGCCGCCGGCTCCGGGTCCCCGG - Intronic
1122630356 14:103104769-103104791 GGCCTCCAGCTCCGCGGAGATGG - Exonic
1127867187 15:63042501-63042523 GGCCGCCGCCTCGGCGGCTCGGG + Intergenic
1128460553 15:67863589-67863611 GGGCGGCGGCTCCGCGGAGGAGG + Intergenic
1129322315 15:74782157-74782179 GGCAGCGGGCTCGGCGGCGGCGG - Exonic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1132893139 16:2214373-2214395 GGCCTCCAGCTCCGCGGCCAGGG + Exonic
1132983898 16:2753367-2753389 GGCCCCCGGCGCTGCGGGGAGGG + Intronic
1134615745 16:15650188-15650210 GACCGCAGGCTCCGGGGCGGGGG + Intronic
1136605765 16:31332250-31332272 GGCCGCAGGCTCGCAGGCGACGG - Exonic
1139806177 16:69566570-69566592 GGCCGGCGGCTCCGCGGGGGAGG - Intronic
1141683375 16:85556632-85556654 GGGAGCCGGCTCCGCCGCGGCGG + Intergenic
1142141209 16:88473609-88473631 TGACGCAGGCTGCGCGGCGATGG + Intronic
1143747352 17:9003928-9003950 GGCCGGCGGGTCCGCGGCGCGGG - Intergenic
1144021229 17:11241294-11241316 GGTCAGCGGCTCCGGGGCGATGG - Exonic
1146371054 17:32265902-32265924 CGCGCCCGGCTCCGAGGCGAGGG - Intergenic
1149610317 17:57954766-57954788 GGGCGCAGGCTGGGCGGCGACGG - Intronic
1151854387 17:76710749-76710771 GGCCGCCGGCTCGGGGGCGCAGG + Exonic
1152222209 17:79075059-79075081 GGCCGCCGCCGCCGCGGCCGCGG - Exonic
1152717104 17:81905472-81905494 GGCCGCTGCCTCCCCGGGGAGGG - Intronic
1153911251 18:9708249-9708271 GGCCGCCGGCCCCGCCGCGGTGG - Exonic
1160824125 19:1071513-1071535 GGCCGCCGGCTTCCCGGGTAGGG + Intronic
1160853528 19:1205996-1206018 GGCCGCAGGCTCCGGGCCGGGGG - Intronic
1160873164 19:1286074-1286096 GCCCGCCCGCTCGGCGGCGGCGG + Intergenic
1160954174 19:1682523-1682545 GGACGGCGGCTCCCAGGCGAGGG - Intergenic
1160970806 19:1766979-1767001 GGCCCCGGGCTCCGCTGCGGGGG + Intronic
1161404330 19:4083196-4083218 GGCTGCAGGCTCCCCAGCGATGG + Intergenic
1162987147 19:14277935-14277957 CGCCCCCTGCTCCGCGGCGCCGG + Intergenic
1164693567 19:30227646-30227668 GGCCGGCGGGGCCGGGGCGAGGG + Intergenic
1165157742 19:33798062-33798084 GCCGGCTGGCTCCGCGGCGGAGG + Intronic
1166543248 19:43619454-43619476 GACCGCCGGCTCCCCGGTGACGG + Intronic
927159218 2:20242386-20242408 GGCCCCCGGACCCGCGGCGCAGG + Intergenic
927168583 2:20350324-20350346 GGCCGCCGCCTCGGGGGCGTGGG - Intronic
927213146 2:20650938-20650960 GGCCGCCGCCTCCTAGGCCAGGG - Intronic
927920772 2:26970702-26970724 GGCCGGCGGCTCCGGGGCGGAGG - Exonic
929604670 2:43226563-43226585 TGCCGTCGGCTCCGCGGGGGGGG - Exonic
934566786 2:95345952-95345974 CGCCGCCTGCTCCGCAGAGAGGG - Intronic
937045132 2:118847102-118847124 CGCCGCCGCCGCCGCGCCGAGGG + Exonic
941104895 2:161341129-161341151 GGCCGCCGGCTCGGGGGCGCAGG + Intronic
942748684 2:179264520-179264542 GGCCGGCGGCTCCGGGGCGTTGG + Exonic
945241530 2:207681377-207681399 GGCGGGCGGATCCGCGGGGAGGG + Intergenic
1169309214 20:4521248-4521270 GGCTGCAGGCTCCACGGAGAGGG + Intergenic
1169914688 20:10673602-10673624 GGCCGCAGGGGCAGCGGCGACGG - Exonic
1174258796 20:49278262-49278284 GCCCGCCGGCTCCGCCGCCGGGG - Intronic
1175847213 20:62065312-62065334 GCCCGCCGGCCCCGCCGCGCTGG - Exonic
1175847230 20:62065355-62065377 GGGCTCGGGCCCCGCGGCGACGG + Exonic
1176232287 20:64038613-64038635 GGCCGCCGGCTCCGCTGTCGGGG - Intronic
1179529912 21:42011052-42011074 GGCCGCCGGGTCCCCGCCCAGGG - Intergenic
1179893701 21:44350282-44350304 GCCCGCCGGGGCCGGGGCGAGGG + Intronic
1180005421 21:45018560-45018582 GGCCGCCGAGCCCGCTGCGAGGG + Intergenic
1181934545 22:26429384-26429406 AGGCGGCGGCTCCGCGGCGCCGG + Exonic
1182447221 22:30396984-30397006 GGCTGCCAGCTCCGCGGCCCGGG + Exonic
1182576481 22:31276585-31276607 GCTCGCCGGCTCCGCGGCGAGGG - Intronic
1184222463 22:43109939-43109961 GGCAGCCTGCTACGCGGGGATGG - Intergenic
949896006 3:8768119-8768141 GGCCCCCGGCGGCGCGGCGCTGG + Exonic
950084666 3:10248762-10248784 GGCTGCCGGATCCGCGGCCCCGG - Exonic
953375238 3:42422743-42422765 GGCAGCCGGCTCCCCGGCGAGGG + Intergenic
962259719 3:133895095-133895117 GGCGGCTGGCTCCGCGGCGCTGG - Intronic
965596812 3:170418892-170418914 GGCTGCGAGCTCAGCGGCGAAGG - Exonic
966108161 3:176362256-176362278 CGCCCCCTGCTCCGCGGCGCCGG - Intergenic
972586208 4:40438830-40438852 GGCCGCCGGGTCCTCCGCCAAGG - Exonic
972739891 4:41879205-41879227 GTCCTGCGGCTCCGGGGCGAAGG + Intergenic
973754823 4:54064399-54064421 TGCCGCCGGCTCCGAGGCCGCGG + Exonic
975883581 4:78939305-78939327 GTCCGCGGGCTCCGGGGCGGGGG - Exonic
983537955 4:168878106-168878128 GGCCTCGGGCTCAGCGCCGAAGG - Intronic
984206459 4:176792757-176792779 GGCCGCGGGCGCTGCGGCGGGGG + Intergenic
986747966 5:10760926-10760948 GGGCGGGGGCTCCGCGGGGAGGG - Intronic
986748144 5:10761567-10761589 GGCTCCTGGCTACGCGGCGACGG + Intergenic
987234319 5:15927998-15928020 GGCCACCGTCTCCCCGGTGATGG - Exonic
987402334 5:17491365-17491387 GCCCGCCGCCTCCGTGGAGAGGG - Intergenic
987415192 5:17655135-17655157 GCCCGCCGCCTCCGCAGAGAGGG - Intergenic
989812671 5:45696209-45696231 CGCCGCCGCCGCCGCCGCGACGG - Intergenic
992228355 5:74640503-74640525 GGACACCGGGTCCGCGGCGTGGG - Exonic
992561531 5:77957679-77957701 GGCCCCCAGCTCCGGGGAGATGG - Intergenic
996404229 5:123090391-123090413 GGGCAGCGGCTCGGCGGCGACGG - Exonic
997990807 5:138543136-138543158 CGGCGGCGGCTCCGCGGCGGCGG + Exonic
1002047317 5:176549384-176549406 GCCTGCCGCCTCCGTGGCGAAGG + Intronic
1004044726 6:12012570-12012592 CGGCGCGGGCTCCGCGGCGGGGG + Intronic
1005303777 6:24495065-24495087 GGCCGCCGGCGCGGGGGCGGAGG - Exonic
1005988068 6:30886370-30886392 GGCAGCCTGCTCCCCGGCGCTGG + Intronic
1013793701 6:113860467-113860489 GGCCGCGGGCTCCTCCGCGGGGG - Exonic
1017672364 6:156779108-156779130 GGCCGCCGGCTCGGCGGCGGGGG + Exonic
1018208561 6:161458422-161458444 GGCTGCCTCCACCGCGGCGAGGG - Intronic
1022090087 7:27102287-27102309 GGCCGCCAGCGCCGTGGCGAGGG + Exonic
1028621897 7:92835298-92835320 AGCCCCGGGCTCCGCAGCGAAGG + Intronic
1029098394 7:98107185-98107207 GGCCGCCGGCGTTGCGGCGGAGG + Exonic
1029456218 7:100673843-100673865 CGCCGCCGCCTCCGCCGCGGAGG + Exonic
1032306032 7:130733485-130733507 GGGCGCCTGATCCGCGGCGGGGG + Exonic
1034951295 7:155298359-155298381 GGCCGCCAGCCCCGCGGCGCTGG - Exonic
1037827011 8:22165560-22165582 GCCCCCCGGCCCCCCGGCGACGG + Intronic
1038147698 8:24913680-24913702 GGCCGCCGCCTCCACGGGGCGGG + Exonic
1040501441 8:48008628-48008650 GGCCGCCGGGGCCTCGGCGCCGG - Intronic
1042532870 8:69833010-69833032 GGCCGCGGGCCCAGCGGCGGCGG - Exonic
1044698914 8:94949193-94949215 GGCCGCCGGCTCGGCGGGGAAGG + Exonic
1044973778 8:97644341-97644363 GGCCGCTGCCACCGCGGGGAGGG - Exonic
1049218371 8:141417915-141417937 TGGAGCCGGCTCCGCGGCGGAGG + Intronic
1052903989 9:33817739-33817761 CGCCGCCGCCGCCGCCGCGATGG + Exonic
1053399029 9:37801137-37801159 GGCCGCCGGCACGGAGGGGAGGG - Exonic
1053550920 9:39078720-39078742 GGCGTCCGGCTCCCCGGCGCGGG - Exonic
1053815029 9:41898799-41898821 GGCGTCCGGCTCCCCGGCGCGGG - Exonic
1054615567 9:67288642-67288664 GGCGTCCGGCTCCCCGGCGCGGG + Intergenic
1057489149 9:95508373-95508395 CGCCGCCGCCGCCGCGGGGACGG + Exonic
1058508851 9:105694551-105694573 GGCCGCCCGCTCCTCCGCGCCGG - Exonic
1060200943 9:121651569-121651591 AGCAGCCGGCCCCGCGGCGGGGG - Intronic
1060811468 9:126613375-126613397 GGCCGCTTGGTCCGCGGAGAGGG - Intergenic
1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG + Exonic
1062162637 9:135088392-135088414 CTCCCCCGGCCCCGCGGCGAGGG - Intronic
1062272143 9:135714474-135714496 GGCCGCGGGCTGCGCTGCGCGGG + Intronic
1062472458 9:136712494-136712516 GGCCGACGGCGGCGCGGCGGGGG - Intergenic
1062556166 9:137114276-137114298 GGCCGCCAGCTCCGCGACGAAGG + Exonic
1203773676 EBV:61499-61521 CGCCGCCGCCCCCGCCGCGACGG - Intergenic
1185892792 X:3835584-3835606 GGCCGCCGCATCCGCCGCGGCGG + Intronic
1185897900 X:3874004-3874026 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1185903019 X:3912435-3912457 GGCCGCCGCATCCGCCGCGGCGG + Intergenic
1190109762 X:47582437-47582459 GGGCGCTGGATCTGCGGCGATGG - Exonic
1200128765 X:153830212-153830234 GGCCGCCGGCGCTGCGGCGGGGG - Intronic