ID: 1061078412

View in Genome Browser
Species Human (GRCh38)
Location 9:128355551-128355573
Sequence TCGAGGTGCCAGGTATGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061078406_1061078412 12 Left 1061078406 9:128355516-128355538 CCTGCTGGACATGGCTGACGTGG 0: 1
1: 0
2: 1
3: 7
4: 106
Right 1061078412 9:128355551-128355573 TCGAGGTGCCAGGTATGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 114
1061078405_1061078412 15 Left 1061078405 9:128355513-128355535 CCGCCTGCTGGACATGGCTGACG 0: 1
1: 0
2: 0
3: 14
4: 128
Right 1061078412 9:128355551-128355573 TCGAGGTGCCAGGTATGTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061078412 Original CRISPR TCGAGGTGCCAGGTATGTGC AGG Exonic
900201935 1:1411927-1411949 TCGAGGTCCCAGGTCTGTCTAGG + Intergenic
900201999 1:1412132-1412154 TCGAGGTCCCAGGTCTGTCCAGG + Intergenic
903260943 1:22131695-22131717 TCTAGGTGCCAGGTAATTGTGGG + Intronic
903877427 1:26484961-26484983 TACAGGTGCCAGCTAAGTGCTGG - Intergenic
904359394 1:29962133-29962155 ACTATGTGCCAGGTATGTGCTGG - Intergenic
905275175 1:36812989-36813011 ACGACGTGCCAGGGCTGTGCAGG + Intronic
911575447 1:99571997-99572019 ACTATGTGCCAGGCATGTGCTGG - Intergenic
923514691 1:234685196-234685218 TCTAGGTGACAGGTATTTGGAGG - Intergenic
923738262 1:236632338-236632360 CTGAGGTGCCAGGTATGTTAGGG + Intergenic
1062818915 10:519497-519519 TGGAGGTCCCATGTATGTGTGGG - Intronic
1066301588 10:34101993-34102015 GCCAGGTGCCATGTATATGCTGG - Intergenic
1066321140 10:34305254-34305276 TCCAGGCCCCAGGTATGGGCTGG + Intronic
1067266581 10:44750764-44750786 TCGTGGTGCCAGAGATGTCCAGG + Intergenic
1068679862 10:59808067-59808089 TAGAGGTGCCAGCTATATACAGG - Intronic
1073454655 10:103629258-103629280 TCGTGGTGACAGGCAGGTGCTGG + Intronic
1073516784 10:104083044-104083066 CTGAGGTGCCAGGTACGTGTTGG + Intronic
1075150680 10:119927450-119927472 TCGAGCTGCTAGGGATTTGCTGG + Intronic
1077907903 11:6547947-6547969 ACGATGTGCCAGATAAGTGCAGG + Exonic
1081968366 11:47182993-47183015 TCTAGGCCCCAGGTATGTGGGGG - Exonic
1082881013 11:58038245-58038267 TTGAGGTGCATGATATGTGCAGG + Intronic
1083026892 11:59558662-59558684 TCGAGTTGACTAGTATGTGCTGG - Intergenic
1088168355 11:106965712-106965734 TCCATGTGCCAGGCCTGTGCTGG - Intronic
1090329265 11:125917726-125917748 TCCATGTGCCAGATAGGTGCTGG - Intronic
1091062298 11:132474851-132474873 TTGAGGTGCCAGGTATGACTAGG - Intronic
1091591850 12:1847056-1847078 AGGAGGTGCCTGGTACGTGCTGG - Intronic
1096257793 12:50073548-50073570 TCCTGGTGCCAGGGATTTGCAGG - Intronic
1099269674 12:80492134-80492156 TCCAGGTGGCAGGTATATGGAGG - Intronic
1099444296 12:82733935-82733957 TTGAGGGCCCAGGTAGGTGCAGG + Intronic
1101392598 12:104315885-104315907 TCGAGGAGACAGGTATGAGAGGG + Exonic
1104924823 12:132308652-132308674 CCGAGGTGCCAGGTGGGTCCCGG - Intronic
1113755250 13:112806997-112807019 ACAAAATGCCAGGTATGTGCAGG - Intronic
1113963811 13:114140360-114140382 TCAAGGTGCCAGGGATTTGTGGG - Intergenic
1115791480 14:36883610-36883632 ACTAGGTGCCAGGCATGTTCTGG - Intronic
1116125295 14:40776398-40776420 TAGATGTGGCAGGGATGTGCTGG - Intergenic
1119920063 14:78438604-78438626 CCGAGGTGCCAGGTGTGTAGAGG - Intronic
1128323062 15:66705963-66705985 TCAAGGTGCCAGGCACGTTCAGG + Intronic
1131132043 15:89906413-89906435 GCCAGGTGCCAGGGATTTGCAGG - Intronic
1133127173 16:3654558-3654580 GGGATGGGCCAGGTATGTGCGGG - Intronic
1136412046 16:30083268-30083290 AAGAGGTGCCAGGAGTGTGCTGG + Intronic
1139612025 16:68066092-68066114 ACTAGGTGCCAGGCAGGTGCTGG + Intronic
1140906304 16:79412298-79412320 CCGTGGTACCAGGTATGTGCAGG + Intergenic
1141073008 16:80975209-80975231 TCGAGGTGCCAGTTAACTCCTGG - Exonic
1141496309 16:84412767-84412789 TTGAGCAGCCAGGTATGTTCGGG - Intronic
1142174542 16:88639133-88639155 TCGAGGTGCCAAGTGGGGGCAGG + Exonic
1142947388 17:3442855-3442877 TGGTGGAGCTAGGTATGTGCAGG - Intronic
1143377177 17:6473678-6473700 TCGAGGTTGCAGGTATTAGCCGG + Intronic
1143513874 17:7409711-7409733 TGGAGGTGCTGGGTATGTACAGG - Intronic
1144743610 17:17598336-17598358 TCTGGGTGCCAGGTGTGTACTGG - Intergenic
1146370917 17:32265521-32265543 TGGAGGTGGCAGATATGTGATGG - Intergenic
1148406853 17:47423636-47423658 TCTGGGTTCCAGGTAGGTGCGGG + Intronic
1148650159 17:49244680-49244702 TCTAAGTGCCAGGTATGTGTTGG + Intergenic
1150847891 17:68677808-68677830 CTGAGGTGTCAGGTATGTGAAGG - Intergenic
1152642798 17:81456188-81456210 TCGAGGTACCAGTTCTGAGCCGG + Intronic
1154337117 18:13474718-13474740 ACAAGGTGCCAGGTAGGTGTGGG - Intronic
1158836211 18:61333950-61333972 TCGAGGTGGCAGGGAGTTGCTGG - Intronic
1162343822 19:10108149-10108171 GCGAGGTGGCAGGTATGGGGGGG + Intronic
1165982276 19:39734871-39734893 TGGAAGTGCCATGAATGTGCAGG - Intronic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1167110950 19:47460802-47460824 TCCATGTGCCAGGCCTGTGCTGG - Intronic
1167618673 19:50549628-50549650 TGGAGGTGACAGGTGTGGGCAGG + Intronic
925440006 2:3877542-3877564 TCCAGGTGCCAGGCTTGTGCTGG + Intergenic
928036681 2:27830667-27830689 ACTAAGTGCCAGCTATGTGCAGG + Intronic
931640418 2:64376204-64376226 TGGTGGTGCCATGTTTGTGCTGG - Intergenic
933585764 2:84178031-84178053 TTAAAGTGCCAGGTATGTCCTGG + Intergenic
936528632 2:113259443-113259465 TCAAGGAGCCAGGTGTCTGCGGG - Intronic
936889552 2:117353314-117353336 TCCAGGTACCAAGTATGAGCTGG - Intergenic
938558249 2:132446261-132446283 ACTATGTGCCAGGCATGTGCTGG + Intronic
942824761 2:180162217-180162239 TCTACTTGCCAGCTATGTGCCGG + Intergenic
948842123 2:240656804-240656826 TCTACTTGCCAGCTATGTGCAGG - Intergenic
1172790857 20:37504582-37504604 TTGAGGAGCCAGGTGTGGGCAGG - Intronic
1173015971 20:39226060-39226082 TCTATGTGCCAGACATGTGCTGG + Intergenic
1173016913 20:39234229-39234251 TCCAAGTGCCAGGTGTGGGCAGG + Intergenic
1174507602 20:51026680-51026702 ACGAGGTGCCAGGTGGTTGCTGG + Intergenic
1175368509 20:58471263-58471285 TCGAGGGGCCTGCTGTGTGCCGG - Intronic
1176079929 20:63267281-63267303 TGGAAGTGCCAGGTAAGTTCTGG - Intronic
1176083647 20:63286171-63286193 CAGCGGTGCCAGGTGTGTGCGGG - Intronic
1176121807 20:63457494-63457516 TGTAGGTGCCAGGTGGGTGCAGG - Intronic
1179518139 21:41923873-41923895 GCCAGGTGCCAGGTGTGTACTGG + Intronic
1180220057 21:46352850-46352872 TCGAAGTGGCAGGGATGTGGGGG - Intronic
1183148394 22:36016835-36016857 TCTAGATGCCACGTAAGTGCAGG + Intronic
1183622331 22:38981873-38981895 TCGAGTTCCCAGCTGTGTGCTGG - Intronic
950012328 3:9732127-9732149 TCGAGGTGGCCGGTGAGTGCGGG + Exonic
954447103 3:50552709-50552731 CCTGGGTGCCAGCTATGTGCAGG + Intergenic
957229135 3:77489192-77489214 TTGATGTGTCATGTATGTGCAGG + Intronic
960036535 3:113107947-113107969 AGGAGGTGGCAGGTAGGTGCTGG + Intergenic
960142354 3:114163334-114163356 TCTAGGTGCCAAGAATATGCTGG + Intronic
962740313 3:138358597-138358619 TCTCTGTGCCAGATATGTGCTGG + Intronic
966675246 3:182579063-182579085 TCAAGATGCCAGGTATATGGTGG + Intergenic
971003391 4:22347477-22347499 TTGAGGTGTCAGGAATGGGCAGG + Intronic
972577302 4:40363752-40363774 TCCAGTTGCCAGGTTTGTCCCGG - Intergenic
976736868 4:88319080-88319102 TTGATGTGCCAGGCATGTGGGGG + Intergenic
980138926 4:128892692-128892714 GCCAGGTGCAAGGTATGTGGTGG + Intronic
989131969 5:38115629-38115651 TCAAGGTGCCAGGAAACTGCTGG + Intergenic
998069597 5:139186762-139186784 TCTATGTGCCAGGACTGTGCTGG + Intronic
998852039 5:146360387-146360409 TCGGAGAGCCAGGGATGTGCTGG + Intergenic
1000338905 5:160261889-160261911 ACTATGTGCCAGGCATGTGCTGG - Intronic
1000424759 5:161077573-161077595 TCCAGGTTCAAGGTATGTGTAGG + Intergenic
1001835060 5:174824720-174824742 TCGAGGTGTTAGGTATTAGCCGG - Intergenic
1010781313 6:79948001-79948023 TCATGGTGACAGGCATGTGCTGG - Intergenic
1015290465 6:131532693-131532715 CCGAGGTGGCACGTTTGTGCTGG + Intergenic
1017670543 6:156765680-156765702 TCTAAGTGCCAGATATGTGCGGG - Intergenic
1018667490 6:166152500-166152522 TCCAGGTGCAAAGTATGTCCTGG - Intergenic
1023528736 7:41131541-41131563 TCCAGGTGCCACCTATGTGCTGG + Intergenic
1023724123 7:43124665-43124687 TCGAGGTGCAAAGTCAGTGCTGG + Intronic
1024659495 7:51479165-51479187 TCGAGGAGCCAGGGCTGGGCGGG + Intergenic
1025231176 7:57204152-57204174 TCTGGGTGCCCGGTATCTGCTGG + Intergenic
1025243848 7:57300962-57300984 TCATGGTGTCAGGTCTGTGCAGG + Intergenic
1026169416 7:67940830-67940852 TCATGGTGCCAGGTCTGTGCAGG + Intergenic
1029318592 7:99736855-99736877 GTGTTGTGCCAGGTATGTGCCGG + Intergenic
1033039286 7:137903646-137903668 TAGAAGTTCCAGGAATGTGCAGG + Intronic
1034199967 7:149278237-149278259 TCTAGCTGCCAGGTATTTGGTGG + Intronic
1041762039 8:61377727-61377749 ACTAGGTGCCAGATATTTGCTGG - Intronic
1042246410 8:66712822-66712844 CCGCGGGGCCAGGTAGGTGCGGG + Intronic
1044515581 8:93134631-93134653 GAGAGGTGCCAGGGATGTCCAGG - Intronic
1048235295 8:132683793-132683815 TCCAGGTGCCAGTTTTCTGCTGG + Intergenic
1051355309 9:16234931-16234953 TCCAGGTACCAGCTCTGTGCAGG - Intronic
1058402804 9:104636976-104636998 TCGAGGTACCAGGCTGGTGCAGG - Intergenic
1060868904 9:127023355-127023377 TCTAAGTGCCAGGACTGTGCTGG - Intronic
1061078412 9:128355551-128355573 TCGAGGTGCCAGGTATGTGCAGG + Exonic
1062394852 9:136348649-136348671 GCGAGGTGCCAGGGTGGTGCTGG + Intronic
1189888696 X:45576927-45576949 TATAGGTGCCAGTGATGTGCTGG + Intergenic
1192430103 X:71106040-71106062 TCGAGCTGTAAGGTATTTGCTGG + Exonic
1195422486 X:104691109-104691131 TAGAGGTTCCAGATATTTGCAGG + Intronic