ID: 1061080196

View in Genome Browser
Species Human (GRCh38)
Location 9:128365262-128365284
Sequence TCCAGCAGGCCGGCCAGCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061080196_1061080207 16 Left 1061080196 9:128365262-128365284 CCCGGGCTGGCCGGCCTGCTGGA No data
Right 1061080207 9:128365301-128365323 GCCCAAGCCCCTGTTCTGTGTGG No data
1061080196_1061080214 26 Left 1061080196 9:128365262-128365284 CCCGGGCTGGCCGGCCTGCTGGA No data
Right 1061080214 9:128365311-128365333 CTGTTCTGTGTGGACCCAAAGGG No data
1061080196_1061080213 25 Left 1061080196 9:128365262-128365284 CCCGGGCTGGCCGGCCTGCTGGA No data
Right 1061080213 9:128365310-128365332 CCTGTTCTGTGTGGACCCAAAGG No data
1061080196_1061080206 -6 Left 1061080196 9:128365262-128365284 CCCGGGCTGGCCGGCCTGCTGGA No data
Right 1061080206 9:128365279-128365301 GCTGGAGGGAACAGGGAATGGGG No data
1061080196_1061080204 -8 Left 1061080196 9:128365262-128365284 CCCGGGCTGGCCGGCCTGCTGGA No data
Right 1061080204 9:128365277-128365299 CTGCTGGAGGGAACAGGGAATGG No data
1061080196_1061080205 -7 Left 1061080196 9:128365262-128365284 CCCGGGCTGGCCGGCCTGCTGGA No data
Right 1061080205 9:128365278-128365300 TGCTGGAGGGAACAGGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061080196 Original CRISPR TCCAGCAGGCCGGCCAGCCC GGG (reversed) Intergenic
No off target data available for this crispr