ID: 1061082740

View in Genome Browser
Species Human (GRCh38)
Location 9:128382026-128382048
Sequence CCTCCCTACTTGGGTAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 212}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061082740_1061082750 30 Left 1061082740 9:128382026-128382048 CCAGAGTTACCCAAGTAGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 212
Right 1061082750 9:128382079-128382101 CATCTTCCAGCCACTGTTCAGGG No data
1061082740_1061082749 29 Left 1061082740 9:128382026-128382048 CCAGAGTTACCCAAGTAGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 212
Right 1061082749 9:128382078-128382100 TCATCTTCCAGCCACTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061082740 Original CRISPR CCTCCCTACTTGGGTAACTC TGG (reversed) Intronic
900437794 1:2639788-2639810 CCTCCCACCTTGAGTACCTCGGG - Intronic
901164190 1:7205217-7205239 CCTAGCTACTTGGGTAAGGCAGG - Intronic
902734355 1:18390452-18390474 CCTCCCTGCCTGGGTTTCTCTGG - Intergenic
906451922 1:45957575-45957597 CCTAGCTACTTGGGTGACTGAGG - Intronic
906593265 1:47048131-47048153 CCTGCCTACTTGGGGGACTGAGG + Intronic
908483403 1:64566395-64566417 ACCCCCTACTTGGGTGACCCTGG - Intronic
909592588 1:77367436-77367458 CCTAGCTACTTGGGAAACTGAGG - Intronic
912777900 1:112517555-112517577 CCTCTCTACTTGGGCAGCACTGG - Intronic
914931243 1:151935661-151935683 CCTAGCTACTTGGGGAACTAAGG - Intergenic
917666669 1:177231712-177231734 ACTCCCTGCTTTGGTGACTCTGG + Intronic
918486512 1:185034489-185034511 CCTAGCTACTTGGGAAACTGAGG + Intergenic
920352893 1:205349426-205349448 CCTGCCTACTTAGGTAAAACTGG + Intronic
920923332 1:210317304-210317326 CCCAGCTACTTGGGTAACTGAGG - Intergenic
921105163 1:211969669-211969691 CCCGGCTACTTGGGAAACTCAGG - Intronic
921920097 1:220658845-220658867 GCTCCCTACTGTGGTGACTCAGG - Intronic
922482947 1:225951596-225951618 CCTACCTACTTGGGAGGCTCAGG - Intergenic
924897307 1:248355302-248355324 CCTCGCTACTTGGGAAGCTGAGG - Intergenic
1064348064 10:14550644-14550666 CATGACAACTTGGGTAACTCAGG - Intronic
1070001718 10:72383128-72383150 CCTAGCTACTTGGGAAACTGAGG + Intronic
1070221452 10:74450196-74450218 CCTAGCTACTTGGGAAGCTCAGG + Intronic
1072643672 10:97234149-97234171 CCTACCTACTTGGGAAGCTGAGG + Intronic
1074393750 10:113079771-113079793 CCCAGCTACTTGGGTAACTGAGG - Intronic
1074768571 10:116718438-116718460 CCTCCAAACCTGGGTAACTCGGG + Intronic
1075016257 10:118911974-118911996 GCTCCATGCTTGGGTGACTCAGG - Intergenic
1075510904 10:123072537-123072559 CCTCCCTACCAGGATAACACAGG - Intergenic
1078214229 11:9297947-9297969 CCTACCTACTCGGGAAACTGAGG + Intronic
1078758352 11:14232542-14232564 CCTCCCCACTCTGGCAACTCTGG + Intronic
1079388327 11:20000077-20000099 CCTCTGTCCTTGGGGAACTCTGG + Intronic
1079655140 11:22977329-22977351 CCTCACTATTTAGCTAACTCGGG - Intergenic
1079896667 11:26127927-26127949 CCTACCTACTTGGGAGACTGAGG - Intergenic
1080445794 11:32335718-32335740 CCTAGCTACTTGGGTAGCTGAGG + Intergenic
1081166763 11:39817343-39817365 ACTCCCAACTTGGGCAACTGAGG + Intergenic
1081955983 11:47093703-47093725 CCTTACTACTGGGGAAACTCAGG - Intronic
1082199276 11:49343993-49344015 CCTCGCTACTTGGGAAGCTGAGG - Intergenic
1082852234 11:57775701-57775723 CCTTCCTCCTTGGTTAACTCTGG + Intronic
1084042056 11:66547914-66547936 CCCCTCTACTTGGGAAAGTCTGG - Intronic
1085610205 11:77940750-77940772 CCTAGCTACTTGGGTGACTGAGG - Intronic
1089010466 11:115127999-115128021 CCTCCCTAAGTGTGTGACTCAGG + Intergenic
1089416116 11:118292308-118292330 CCTACCTACTTGGGAAGCTGAGG + Intergenic
1089951257 11:122529427-122529449 CCTGCTTACTTGGGTGACTGAGG + Intergenic
1090399855 11:126442143-126442165 CCTCCCTACTTGGGAGGCTGAGG + Intronic
1090422303 11:126583846-126583868 CCTCCCTACCTGGCTGCCTCGGG - Intronic
1090633158 11:128668477-128668499 CCTCCCTGCCTGAGAAACTCAGG + Intergenic
1091468391 12:705452-705474 CCTAGCTACTTGGGTGACTGAGG - Intergenic
1093037490 12:14346582-14346604 CTTCCCTACTTTAGAAACTCTGG + Intergenic
1094194780 12:27736989-27737011 CCTAGCTACTTGGGAAACTGAGG - Intronic
1096193745 12:49635784-49635806 CAGGCCTACTTGGGTAGCTCTGG + Intronic
1096514433 12:52148294-52148316 CCTCCCTACTTGGGGGATCCAGG + Intergenic
1096563126 12:52451448-52451470 CCTCCCTCCTAGGGTCTCTCCGG + Intronic
1096725058 12:53554745-53554767 CCTACCTACTTGGGAGACTGAGG + Intronic
1097094252 12:56533214-56533236 CCTACCTACTTGGGAAGCTGAGG - Intronic
1097440843 12:59606126-59606148 CCTTCCTACTTGGGTCATGCTGG - Intronic
1100418127 12:94399615-94399637 CCTAGCTACTTGGGTACCTGAGG + Intronic
1101093162 12:101308622-101308644 CCTACCTACCTGCGTCACTCAGG - Intronic
1102201821 12:111062781-111062803 CCTCCTCACTGGGCTAACTCAGG - Intronic
1103109375 12:118261974-118261996 CCTAGCTACTTGGGTGACTGAGG - Intronic
1103753348 12:123182796-123182818 CCTGCCTACTTGGGTGGCTGAGG + Intronic
1104109749 12:125694020-125694042 TCCCCCTACTTGGGAAGCTCAGG + Intergenic
1105431605 13:20342306-20342328 CCTAGCTACTTGGGAAACTGAGG - Intergenic
1105483462 13:20802171-20802193 CCCAGCTACTTGGGAAACTCAGG - Intronic
1105681943 13:22736973-22736995 CCTCTCTGCTTGGGAAACCCTGG - Intergenic
1107514482 13:41115757-41115779 CCACCCTACTTGGGGAGCTGAGG - Intergenic
1108596358 13:51953278-51953300 CCTCCCGACTTGGGCTTCTCAGG - Intronic
1109140178 13:58704811-58704833 CCTACCTACTTGGGAAGCTGAGG + Intergenic
1109813419 13:67546371-67546393 CCTCCCTACTTTGGTACCCCCGG - Intergenic
1114297456 14:21342426-21342448 CCTAGCTACTTGGGTGACTAAGG + Intronic
1114505774 14:23211836-23211858 CCTCGCTACTTGGGAGACTGAGG - Intronic
1115571232 14:34668477-34668499 CCTTCCTACAAGGGTTACTCAGG - Intergenic
1117682575 14:58220374-58220396 CCTACCTACTTGTGTGACACTGG - Intronic
1118417876 14:65563159-65563181 CTTTCCTACTTGGGGTACTCAGG + Intronic
1118774640 14:68966099-68966121 CCCACCTACTTGGGAAACTGAGG + Intronic
1118839556 14:69500522-69500544 CCACCCAACTGGGGTCACTCAGG - Intronic
1119229930 14:72971717-72971739 CCTAGCTACTTGGGAGACTCAGG - Intronic
1119828226 14:77676109-77676131 CCTACCTACTTGGGAGACTAAGG - Intronic
1122763485 14:104048352-104048374 CCTACCTACTTGGGAGACTGAGG - Intronic
1123959834 15:25385840-25385862 CCCCTATAATTGGGTAACTCTGG - Intronic
1125835964 15:42751624-42751646 CCTAGCTACTTGGGTAGCTGAGG + Intronic
1126348380 15:47718946-47718968 CCTCCTTCCTTGGGTAATTTAGG + Intronic
1126618082 15:50606820-50606842 CCTACCTAATTGGCTAAATCAGG + Intronic
1128340930 15:66822053-66822075 ACTGCCTAGTTGGGTAACTTTGG + Intergenic
1128480715 15:68035579-68035601 CCTAGCTACTTGGGAAACTGAGG - Intergenic
1128528298 15:68427412-68427434 CCTTTCTACCTGGGTGACTCTGG - Intronic
1130334987 15:82951141-82951163 CCTGCCAACTTGGGTGCCTCTGG + Intronic
1133615681 16:7474657-7474679 CCTTATTACTTGTGTAACTCTGG + Intronic
1135350108 16:21721774-21721796 CCTAGCTACTTGGGAAACTGAGG + Intronic
1136249507 16:28994787-28994809 CCTAGCTACTTGGGTGACTGAGG + Intergenic
1138817130 16:60215409-60215431 CCTAGCTACTTGGGTAGCTGAGG + Intergenic
1139831889 16:69806083-69806105 CCCACCTACTTGGGTGACTGAGG + Intronic
1142040971 16:87893886-87893908 CCTAGCTACTTGGGAAACTGAGG - Intronic
1142606860 17:1086856-1086878 CCTCGCTACTTGGGAGACTGAGG + Intronic
1142859426 17:2751941-2751963 ACTTACTACTTGGGTAATTCTGG + Intergenic
1142992318 17:3739636-3739658 CCTCCCTTCTGGGGTAGCTGAGG + Intronic
1146737742 17:35253485-35253507 CCTACCTACTTGGGAAGCTGAGG - Intronic
1148018678 17:44539726-44539748 CCTCCCTCTTTGGAGAACTCAGG + Intergenic
1149911063 17:60567284-60567306 CCTAGCTACTTGGGTAGCTGAGG + Intronic
1150364686 17:64571519-64571541 CCTAGCTACTTGGGAAACTGAGG - Intronic
1152554940 17:81048486-81048508 CCTCCCAACTTGGGGAACAAAGG - Intronic
1153732806 18:8031850-8031872 TCTCTCTTCTTGGCTAACTCAGG - Intronic
1154025505 18:10704079-10704101 CCTCACCAGTTGGGCAACTCTGG + Intronic
1155017625 18:21860921-21860943 CCTACCTACTTGGGGAACTGAGG + Intronic
1156454749 18:37286683-37286705 CCTCCTTACTTGTCTAACCCGGG + Intronic
1157544118 18:48535998-48536020 CCTCCCACCTGGGGGAACTCTGG + Intergenic
1160021375 18:75184315-75184337 CCTCCCTCCTTGTGTAAATGAGG - Intergenic
1161523374 19:4738429-4738451 CCTCCCTGCCTGGCTAATTCGGG - Intergenic
1162910233 19:13844126-13844148 CCTCCCCTTTTGAGTAACTCTGG + Intergenic
1165666764 19:37637318-37637340 CCTACCTACTTGGGAGGCTCAGG - Intronic
1165723347 19:38095323-38095345 CCTCCCTAGCTGTGTGACTCTGG - Intronic
1167755494 19:51410762-51410784 CCTACCTACTTGGGAAGCTGAGG - Intronic
1167867710 19:52341740-52341762 CCTACCTACTTGGGAGACTGAGG - Intronic
1167981677 19:53281420-53281442 CATCCCTACTTGGGTAAATAGGG + Intergenic
925689473 2:6506377-6506399 CCTCCCCACTTGATTACCTCCGG + Intergenic
927217178 2:20674423-20674445 CATCCCTACTTAGGGAGCTCGGG + Intergenic
929279233 2:40060172-40060194 TCCCCAAACTTGGGTAACTCGGG - Intergenic
929542288 2:42831588-42831610 CCTCGCTACTTGGGAAGCTAAGG - Intergenic
929685000 2:44025947-44025969 CCTACCTACTTGGGAGACTGAGG - Intergenic
929993917 2:46813114-46813136 CCTCACTAGCTGGGTGACTCTGG - Intergenic
931452128 2:62377117-62377139 CCTAGCTACTTGGGAAACTGAGG + Intergenic
933095513 2:78173712-78173734 CCTACCTACTTGGGTGGCTCAGG - Intergenic
938587249 2:132703063-132703085 CCTAGCTACTTGGGAGACTCAGG + Intronic
939502393 2:143004166-143004188 CCTCCCTACTTGAATATATCTGG - Intronic
942137101 2:172937103-172937125 CCTACCTACTTGGGAGACTAAGG + Intronic
947816157 2:233038804-233038826 CCTAGCTACTTGGGAGACTCAGG - Intergenic
948853295 2:240718687-240718709 CCACCCACCTTGGGTGACTCCGG + Intronic
1171959774 20:31485445-31485467 CCTCCCTGGCTGGGTGACTCTGG - Intergenic
1172905560 20:38366639-38366661 CCTCCCTGCCAGGGTAACCCAGG + Intronic
1174114483 20:48217674-48217696 ACTTCCTACTTGGGTGTCTCTGG - Intergenic
1180387609 22:12193254-12193276 CCTGGCTACTTGGGAAACTAAGG - Intergenic
1181785268 22:25222143-25222165 CCTCCCTGCTTTGGTAGCCCCGG + Intronic
1182470877 22:30547464-30547486 CTTCCCTACTTGTGTTTCTCAGG - Intergenic
1184574543 22:45352134-45352156 CCTGCCTACTCAGGTGACTCAGG + Intronic
950528804 3:13540588-13540610 CCTCTCTTCTTGAGCAACTCTGG - Intergenic
951516446 3:23565265-23565287 CCTCCCTATTTGGCTAATTCCGG - Intronic
951730591 3:25806694-25806716 CCTAACTACTTGGGAAACTGAGG + Intergenic
952482121 3:33772310-33772332 CCTCCCTGCTTGGGAAGCTGAGG + Intergenic
952690397 3:36198290-36198312 CCTGCCTACTTGGGAAATCCAGG - Intergenic
954050107 3:47967845-47967867 CCTAGCTACTTGGGAAACTGAGG + Intronic
955518951 3:59755693-59755715 CCTCCCTACCTGGGTGCCCCAGG - Intronic
957098557 3:75801088-75801110 CCTGGCTACTTGGGAAACTAAGG - Intergenic
957422018 3:79982568-79982590 CCTCCCTACTTGGGAGGCTGAGG - Intergenic
960142455 3:114164103-114164125 CCTACCTACTTGGGAAGCTGAGG + Intronic
960333067 3:116386586-116386608 CCTACCTACTTGGGAGACTGAGG - Intronic
962922693 3:139965272-139965294 CCTCCCTACTTTGGTATACCAGG + Intronic
964485990 3:157185856-157185878 CCTTCCTACTTGTGTAACCTTGG + Intergenic
965462949 3:168991582-168991604 CTTCCCTACTTGGCAAACTAGGG - Intergenic
965680426 3:171245517-171245539 CCAACCTTCCTGGGTAACTCTGG - Intronic
966649405 3:182282649-182282671 CTTTCCTACTTGGGAAAATCTGG - Intergenic
969295509 4:6268735-6268757 CCTCCCTCCTTGGGTCACTAGGG + Intergenic
969350826 4:6596984-6597006 CCTGCCTCCTTGGGTGACCCTGG + Intronic
970716396 4:18930639-18930661 CCCCCCTCCTTAGGTAACTATGG - Intergenic
970804168 4:20010718-20010740 CCTAGCTACTTGGGAAACTGAGG - Intergenic
973019188 4:45178844-45178866 CCTAGCTACTTGGGAAACTGAGG - Intergenic
973219804 4:47712396-47712418 CCTAACTACTTGGGAAACTGAGG - Intronic
973614740 4:52667095-52667117 CCACCCTACTTGGCTAACTTAGG - Intergenic
974861517 4:67527614-67527636 CCTGCCTACTTGGGAGACTGAGG - Intronic
974931852 4:68368776-68368798 ACTTCTTACTTGGGTAAGTCTGG + Intergenic
975781568 4:77846156-77846178 CCTAGCTACTTGGGTAGCTGAGG - Intergenic
975861557 4:78682582-78682604 CCTCACTACTTGGGAAACTAAGG + Intergenic
977802714 4:101256986-101257008 CTTCCCTACTTGGGCAACCCTGG - Intronic
977938167 4:102828730-102828752 CCTCCCAACTTGGATATTTCAGG - Intronic
979201598 4:117985546-117985568 TCTCCCTTCATGGGTGACTCAGG - Intergenic
979651437 4:123136724-123136746 CCTCGCTACTTGGGAGACTGAGG + Intronic
980533387 4:134084162-134084184 CCTAGCTACTTGGGAAACTGAGG - Intergenic
980539729 4:134177746-134177768 CCTGCCTACCTGGTTACCTCTGG - Intergenic
980770900 4:137371672-137371694 CCTAGCTACTTGGGAAACTGAGG + Intergenic
987337700 5:16911614-16911636 CCCAGCTACTTGGGTAACTGAGG + Intronic
988676472 5:33438433-33438455 CCTACCTACTTGGGAAGCTGAGG + Intergenic
992262926 5:74989058-74989080 CCTACCTACTTGGGAGACTGAGG - Intergenic
993518251 5:88864704-88864726 CCTAACTACTTGGGAAACTGAGG - Intronic
993918288 5:93768694-93768716 CCTCGCTACTTGGGTGGCTGAGG - Intronic
994343465 5:98659544-98659566 CCTCCCTACTTGAGCAGGTCAGG - Intergenic
994370102 5:98958272-98958294 CCCAGCTACTTGGGTAACTGAGG - Intergenic
997329906 5:133052424-133052446 CCTCGCTGCTTGGGGAACGCGGG + Intronic
997819889 5:137055889-137055911 CTTCCCTACATGGGTCATTCTGG - Intronic
998737855 5:145163486-145163508 CCTGGCTACTTGGGTGACTGAGG - Intergenic
998778846 5:145633711-145633733 CCGCCCTACTTGTGTTTCTCTGG + Intronic
998974142 5:147625680-147625702 CCTTCCTACTTGTGTAATCCAGG + Intronic
1000634650 5:163630266-163630288 CCTAGCTACTTGGGAAACTGAGG - Intergenic
1001299103 5:170520961-170520983 CCTCCCTTCTTGGGTTGCTGTGG + Intronic
1001561819 5:172674702-172674724 CCTCCCTGCTTGGGAACCTTGGG + Intronic
1003997154 6:11553421-11553443 CCTCCCTTCTTGGATAATTGGGG + Intronic
1008836585 6:55839430-55839452 CCTCCCTACTTGGGAGGCTGAGG - Intronic
1010962948 6:82167665-82167687 CCTCCCTACTTTTGTAATTTTGG - Intergenic
1013140591 6:107329883-107329905 CCCAGCTACTTGGGTAGCTCAGG + Intronic
1013578710 6:111510721-111510743 CCTGCCAACTCGTGTAACTCAGG + Intergenic
1014951958 6:127566577-127566599 CCTCCCTACTTGGGAGGCTGAGG + Intronic
1015229399 6:130896942-130896964 CCTCCCTACGTGGTCACCTCAGG + Intronic
1018925311 6:168201733-168201755 CCACCCAACTTGGGTCAATCAGG + Intergenic
1022379574 7:29847302-29847324 ACTTCCCACTTGGATAACTCAGG - Intronic
1023100447 7:36712586-36712608 CTTCCCTTTTTGGGTAACCCAGG - Intronic
1023108315 7:36785144-36785166 CCTCCCTCCCTGGGGAACACAGG - Intergenic
1023186295 7:37536667-37536689 CAGCACTACTTGGGAAACTCAGG + Intergenic
1026537429 7:71251523-71251545 CCTAGCTACTTGGGAAGCTCAGG - Intronic
1027312559 7:76963802-76963824 CCTACCTACTTGGGAAGCTGAGG - Intergenic
1029975175 7:104826800-104826822 TCTCTCTACTTTGGTGACTCTGG + Intronic
1030984405 7:116224112-116224134 CCTGCCCACATGGGTACCTCAGG - Intronic
1031080175 7:117250352-117250374 CCTAGCTACTTGGGAAGCTCAGG - Intergenic
1032100311 7:128970894-128970916 CCTCCCTCCTTAGGCAACCCAGG - Intronic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1032774442 7:135096034-135096056 CCCACCTACTTGGGAAACTGAGG + Intronic
1035920122 8:3667621-3667643 CCTCCTTATTTGGGTTGCTCTGG + Intronic
1038242576 8:25823466-25823488 CCTCTCTTCTTGGCTAACTCTGG + Intergenic
1039210513 8:35207389-35207411 CCTACCTACTTGGGAGACTGAGG + Intergenic
1044704889 8:94999237-94999259 CCTAGCTACTTGGGAAGCTCAGG - Intronic
1045540949 8:103084590-103084612 CTTCACTACTTGGGAAACTGAGG + Intergenic
1051200969 9:14623411-14623433 CCTCGCTACTTGGGGGACTTAGG + Intronic
1051742700 9:20266964-20266986 CCTAGCTACTTGGGTAGCTGAGG + Intergenic
1056546905 9:87620803-87620825 TCTCCCTGCTTGGTTTACTCTGG + Intronic
1057872301 9:98727526-98727548 CCTGCCTATCTGGGTGACTCTGG + Intergenic
1059152824 9:111964712-111964734 CCCAGCTACTTGGGTAACTGAGG + Intergenic
1059632437 9:116139184-116139206 CCTACCTACTGGGGGAACTGAGG - Intergenic
1061060360 9:128247167-128247189 CCTGCCTCCTTGGGTCACTGAGG - Intronic
1061082740 9:128382026-128382048 CCTCCCTACTTGGGTAACTCTGG - Intronic
1061253865 9:129442243-129442265 CCTAGCTACTTGGGAAACTGAGG + Intergenic
1061591274 9:131599238-131599260 CCTCGCTACTTGGGAGACTAAGG - Intronic
1190006610 X:46745727-46745749 CCTATCTACTTGGGAAACTGAGG + Intronic
1190179034 X:48175841-48175863 CCAACCTCCTTGGGCAACTCAGG + Intergenic
1190185158 X:48227211-48227233 CCAACCTCCTTGGGGAACTCAGG + Intronic
1190197884 X:48335247-48335269 CCAACCTCCTTGGGCAACTCAGG + Intergenic
1190664631 X:52685682-52685704 CCAACCTCCTTGGGCAACTCAGG + Intronic
1190674791 X:52772736-52772758 CCAACCTCCTTGGGCAACTCAGG - Intronic
1192314308 X:70040120-70040142 ACTTACTAGTTGGGTAACTCTGG - Intergenic
1195045453 X:101051167-101051189 CCTTCCTATTTGGGCTACTCTGG - Intronic
1198848910 X:140943900-140943922 CCTCCCCGCTTTGGTAAATCAGG + Intergenic
1200392999 X:155963337-155963359 CCTAGCTACTTGGGAAACTAAGG + Intergenic
1201897495 Y:19008142-19008164 CTTTCCTACTGTGGTAACTCTGG - Intergenic