ID: 1061082797

View in Genome Browser
Species Human (GRCh38)
Location 9:128382284-128382306
Sequence AGAGCTGGTTAGCAGCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061082795_1061082797 -9 Left 1061082795 9:128382270-128382292 CCTAGGTCACCAACAGAGCTGGT 0: 1
1: 0
2: 1
3: 38
4: 220
Right 1061082797 9:128382284-128382306 AGAGCTGGTTAGCAGCTGCCAGG No data
1061082791_1061082797 13 Left 1061082791 9:128382248-128382270 CCATGGTAACCTAGGTTGGTGAC 0: 1
1: 0
2: 0
3: 5
4: 66
Right 1061082797 9:128382284-128382306 AGAGCTGGTTAGCAGCTGCCAGG No data
1061082793_1061082797 4 Left 1061082793 9:128382257-128382279 CCTAGGTTGGTGACCTAGGTCAC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1061082797 9:128382284-128382306 AGAGCTGGTTAGCAGCTGCCAGG No data
1061082790_1061082797 14 Left 1061082790 9:128382247-128382269 CCCATGGTAACCTAGGTTGGTGA 0: 1
1: 0
2: 0
3: 1
4: 53
Right 1061082797 9:128382284-128382306 AGAGCTGGTTAGCAGCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061082797 Original CRISPR AGAGCTGGTTAGCAGCTGCC AGG Intronic
No off target data available for this crispr