ID: 1061083863

View in Genome Browser
Species Human (GRCh38)
Location 9:128387914-128387936
Sequence CCTTCCCTGAAGCAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 400}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061083853_1061083863 22 Left 1061083853 9:128387869-128387891 CCAGAGTTGTTCATCCAGGGAGA 0: 1
1: 0
2: 1
3: 13
4: 115
Right 1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG 0: 1
1: 0
2: 4
3: 30
4: 400
1061083854_1061083863 8 Left 1061083854 9:128387883-128387905 CCAGGGAGACAGCGTGTGAGTCC 0: 1
1: 0
2: 24
3: 1545
4: 27128
Right 1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG 0: 1
1: 0
2: 4
3: 30
4: 400

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061083863 Original CRISPR CCTTCCCTGAAGCAGGTGGA GGG Intronic
900090234 1:917115-917137 TCTTCCCTGAGGCAGGTTCAAGG - Intergenic
900394061 1:2446005-2446027 CCATCACTGGAGCAGGTGGCAGG - Intronic
900488576 1:2935201-2935223 GCTGCCCTCAGGCAGGTGGAGGG - Intergenic
900893207 1:5464642-5464664 CTTTCCCTGCAGGCGGTGGAAGG - Intergenic
900946157 1:5832425-5832447 CCTTCCCTGGAGAAGGGGGTTGG - Intergenic
901167115 1:7229041-7229063 ATCTCCCTGGAGCAGGTGGAGGG + Intronic
901251913 1:7785049-7785071 CCTTCCCTGGAGCAGGGAAAGGG + Intronic
902265113 1:15257683-15257705 CTTTCCCTTCAGCACGTGGAGGG + Intronic
902602764 1:17551326-17551348 CGGTGCCTGATGCAGGTGGAGGG + Intronic
902801270 1:18831712-18831734 CCTGCCCTGAGGCAGGGGCATGG + Intergenic
903042533 1:20542161-20542183 CCTGCCTTGGAGCAGGTGAAAGG + Intergenic
904312150 1:29635781-29635803 CCTACCCTGATGGAGGTGCAGGG + Intergenic
905251574 1:36652257-36652279 CCTTCCCTAAGGCAGGAGCAGGG + Intergenic
905632727 1:39527578-39527600 CCCTCCCTGGTCCAGGTGGAGGG - Intergenic
905665089 1:39758839-39758861 CCCTCCCTGGTCCAGGTGGAGGG + Exonic
906117150 1:43364560-43364582 GCTTCCCTGGAGCTGGTGGTGGG - Exonic
906901816 1:49843920-49843942 CCTGCCAGGAAGCAGGAGGAAGG + Intronic
907424399 1:54370168-54370190 CCTTCCTGGAAGCTGGTGGCTGG + Intronic
907928020 1:58972954-58972976 CATTCTCTGAAGCATGTGAATGG + Intergenic
908333277 1:63093323-63093345 CCTTCCATCAAGCAGGTCTATGG - Intergenic
908958969 1:69671400-69671422 CCTCTCCTCAAGCAGGAGGAAGG + Intronic
910028653 1:82689159-82689181 CATTTCCTGAAGCATGTGGTCGG - Intergenic
911360696 1:96873018-96873040 CCTACCCTGATGAAGGTGGCAGG + Intergenic
911746005 1:101442503-101442525 CCTGCCTTGGAGCAGGTGAAAGG + Intergenic
911980143 1:104557196-104557218 CTTCCCCTGAAGCAGTTGCAGGG + Intergenic
912379570 1:109240140-109240162 CCCTCCCTGAGGCAGTGGGATGG + Intergenic
912414361 1:109498120-109498142 CCTACCCTGCGGCAGGTAGAAGG - Intronic
912651670 1:111445281-111445303 CCTTCCCTGAGGCAGAAGGATGG + Intronic
912679600 1:111720704-111720726 TCTTCCCTGAAGCAGGAGATGGG + Intronic
912770262 1:112457133-112457155 CTTTCCCTGGAGTAGGTGAATGG - Exonic
913181681 1:116328629-116328651 CCTTGGCTGAAGCAAGTGCATGG + Intergenic
913581000 1:120226637-120226659 GCTTCTCTGAGGCAGGTTGAGGG + Intergenic
913627178 1:120671763-120671785 GCTTCTCTGAGGCAGGTTGAGGG - Intergenic
914397104 1:147280147-147280169 CCTTGCCTGCAGCAGAAGGAGGG + Exonic
914562930 1:148838074-148838096 GCTTCTCTGAGGCAGGTTGAGGG + Intronic
914609897 1:149292148-149292170 GCTTCTCTGAGGCAGGTTGAGGG - Intergenic
914901813 1:151715171-151715193 TCTTCCCTGTGCCAGGTGGAGGG + Intronic
915147676 1:153805021-153805043 CCTTCCCTGAATAGGGTGGGTGG - Exonic
916214919 1:162386091-162386113 ACATCCCTGCAGCAGGGGGACGG - Intronic
916538437 1:165728031-165728053 ACTTCCCAGAAGGAGGTGGTGGG + Exonic
917217547 1:172693377-172693399 CCTCCCCTGAAGCAGTTGCCAGG - Intergenic
917484939 1:175447303-175447325 CCTTCAGAGAAGCAGGAGGAAGG - Intronic
917691538 1:177474966-177474988 CCTCCCCTGGAGCAAGTGGCTGG + Intergenic
918272103 1:182912075-182912097 CCTGCCCTGGGGCAGGTGAAAGG - Intronic
918303287 1:183223484-183223506 CCTTCCCTCAAGCAGCTGACAGG + Intronic
918476256 1:184928251-184928273 CCTCTCCTGAAGCAGAAGGAAGG + Intronic
920197094 1:204235893-204235915 CCTCCCCTGAAGCAGTTGCCAGG + Intronic
920460709 1:206137633-206137655 CATTCCCTGAAGGAGGAGAAAGG - Intergenic
921332859 1:214057338-214057360 GCTTCCCTGAAGCAAGAGGGTGG + Intergenic
921693135 1:218176371-218176393 CCTTCCCAGAATCAAGGGGAAGG - Intergenic
922280151 1:224115122-224115144 CCTCTCCTAAAGCAGGTGGGTGG - Intronic
924435656 1:244038741-244038763 TCTTCCCTGCAGCCTGTGGAAGG + Intergenic
924667212 1:246085466-246085488 CCTTCCCCGAAGCAGGTCAAAGG + Intronic
1063147702 10:3310941-3310963 ACTTCCCTCCAGCAGGTGGCTGG + Intergenic
1063353487 10:5376903-5376925 CCTTCCCTGACAGAGGAGGAGGG - Intergenic
1065794445 10:29292900-29292922 CCCCCACTAAAGCAGGTGGATGG + Intronic
1065795898 10:29308200-29308222 CCAATCCTGAAGCAGGTGGCAGG - Intronic
1065947067 10:30614466-30614488 CCAATCCTGAAGCAGGTGGCAGG + Intronic
1065948110 10:30625859-30625881 CCTCCCCTAAAGCAGGGGGATGG - Intronic
1066169397 10:32826084-32826106 CCTTCCCTGAGGCAGTTGCCAGG + Intronic
1066397724 10:35042491-35042513 CCTGCCTTGAGGCAGGTGAAAGG - Intronic
1067765489 10:49082854-49082876 GCCTCCCTGAAGCAGATGGCAGG + Intronic
1068712697 10:60151539-60151561 TCTTACCAGAAGCAGATGGATGG + Intronic
1069192639 10:65508827-65508849 CCTCCCCTGAGGCAGGTGCCAGG - Intergenic
1069635605 10:69923005-69923027 TCTTCCCTGGGGCAGATGGATGG + Intronic
1071390910 10:85174614-85174636 GCTTCCAGGATGCAGGTGGAAGG - Intergenic
1071758458 10:88572865-88572887 CATTCCCTGAGGCAGGTAAATGG + Intronic
1072532138 10:96329731-96329753 TCTTCCCAGAAGGAGTTGGAGGG + Intronic
1072686443 10:97540040-97540062 CCTTCTCTGAGGAAGGGGGAGGG + Intronic
1072739753 10:97902309-97902331 CCTTCCCTGAGGCAGGTGGTGGG - Intronic
1072922245 10:99585969-99585991 CCTTCCCTGCAGCATGCTGATGG + Intergenic
1073248553 10:102107963-102107985 TCCTCCCTGAAGCGGGTGGATGG + Exonic
1073854770 10:107661708-107661730 CCTTCCCTGAGGCAGTTGCAGGG + Intergenic
1074021383 10:109587979-109588001 CCTTCCTGGAATGAGGTGGATGG + Intergenic
1074244617 10:111676391-111676413 CCTCCCCTGAAGCAGTTGCCAGG + Intergenic
1075288622 10:121209082-121209104 CCACCCCTGAAGCAGGTGGAAGG + Intergenic
1076055148 10:127366743-127366765 CCATCCCAGAAGCTCGTGGATGG - Intronic
1076221092 10:128733749-128733771 CCCGCCCTGCAGCAGGTGCATGG - Intergenic
1077250813 11:1559841-1559863 CCTGCCCTGCACCAGCTGGAAGG + Intronic
1078332957 11:10441025-10441047 ACTCCCCTGAAGAAGGAGGAGGG + Intronic
1078587122 11:12601401-12601423 CAATCCCTGGAGCTGGTGGAAGG - Intergenic
1078690823 11:13579060-13579082 CACTCCCTGGAGCTGGTGGAGGG - Intergenic
1080796163 11:35565586-35565608 CCTTCCCTGAAGATGATGGGAGG + Intergenic
1080860180 11:36144963-36144985 CCGTCCCGGAAGGAGGTGGGGGG + Intronic
1081906272 11:46672420-46672442 CCTGCTCTGAGCCAGGTGGAAGG + Exonic
1082808069 11:57462392-57462414 CCTTCCCTGAAGCAGCCCGTTGG + Intronic
1083759452 11:64807721-64807743 CATTCCCTGAAGCAGGCACAGGG - Intronic
1084432014 11:69116426-69116448 CCCTCCCTGGAGCAGTCGGAGGG - Intergenic
1084654385 11:70506677-70506699 CCCTCCATGAAGCAGGAGGGAGG - Intronic
1085418809 11:76337987-76338009 CCTTCCCTGGAGTGGGAGGAGGG - Intergenic
1086141680 11:83506563-83506585 CCTCCCCTGAGGCAGGTGCCAGG - Intronic
1087061209 11:93979611-93979633 CATTCCTTGAAAAAGGTGGAAGG + Intergenic
1088407937 11:109501160-109501182 CCTTCCCTGAGGCAGTTGCCAGG - Intergenic
1089606238 11:119643178-119643200 CCTTGCCTGATGCACCTGGAGGG + Intronic
1090215545 11:124959929-124959951 CCTTCCCTGATGCCTGGGGATGG + Exonic
1090381005 11:126327890-126327912 CCCTCACAGCAGCAGGTGGATGG - Intronic
1090433346 11:126665114-126665136 CCTCACCTCAGGCAGGTGGAAGG - Intronic
1091225180 11:133952896-133952918 TCTTCTAGGAAGCAGGTGGAAGG + Intronic
1093302984 12:17477465-17477487 CCTTTCCTGAAGAATGAGGACGG - Intergenic
1094603790 12:31933281-31933303 CCTGCCTTGAGGCAGGTGAAAGG + Intergenic
1094692919 12:32787200-32787222 CCTTCCCTGAGGCTCATGGAGGG - Intergenic
1096771817 12:53939958-53939980 CCTTGCCGGAAGCAGGTTTAGGG - Intronic
1097144636 12:56931741-56931763 CCTTGCATGAAGGAGCTGGAAGG - Intronic
1099050290 12:77774304-77774326 GCTTCCATGAAGCAGTAGGATGG + Intergenic
1100308288 12:93371217-93371239 CCTACCTTGGAGCAGGTGAAAGG + Intergenic
1100713004 12:97277215-97277237 ACTTCCCTGTGGCAGGTGGGTGG + Intergenic
1101263796 12:103063620-103063642 CCTTCCCTGAGGCAGTTGCCAGG + Intergenic
1102633008 12:114298690-114298712 TCTTCCCTGCAGAAGATGGAGGG - Intergenic
1102685110 12:114718457-114718479 CCTTCCCAGAAGGCTGTGGATGG + Intergenic
1102802543 12:115749212-115749234 ACATCCCTGATGAAGGTGGAAGG - Intergenic
1104015622 12:124959931-124959953 CCTGCCCTGGAGCAGGGGGAGGG + Intronic
1104592677 12:130097382-130097404 GCTTCACTGAAGCTCGTGGAGGG + Intergenic
1104899339 12:132179927-132179949 CATTCCCTACAGCAGGTGGTGGG - Intergenic
1105780409 13:23701272-23701294 CCATCACTGAAGCTGATGGAAGG - Intergenic
1107554535 13:41506133-41506155 CCTTCCTGGAAGCAGGAGAATGG - Intergenic
1110875002 13:80498175-80498197 CTTTTCCAGAAGCAGCTGGATGG + Intergenic
1110916798 13:81030932-81030954 CCTTTCCTCAAGCAGAAGGAAGG + Intergenic
1112845100 13:103632667-103632689 GCTTCACTGAAGAAGGTGGGAGG + Intergenic
1113244354 13:108377705-108377727 CCTCCCCTGAAGCTGGGGGAAGG + Intergenic
1113531882 13:111033080-111033102 CCATCCCTGGAGCCCGTGGAGGG + Intergenic
1113702180 13:112396090-112396112 GATTCCCTGAGGCGGGTGGATGG - Intronic
1114248013 14:20933066-20933088 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
1114250847 14:20959165-20959187 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
1116866047 14:50032445-50032467 CCTTTCTTGAAACATGTGGAGGG + Intergenic
1117607044 14:57440576-57440598 CCTCTCCTGAAGCAGAAGGAAGG + Intergenic
1117798457 14:59418842-59418864 GCATCTCTGAAGCAAGTGGATGG + Intergenic
1124192683 15:27594245-27594267 CTTTCCCTGAGGATGGTGGAAGG + Intergenic
1124870463 15:33536512-33536534 CTGTCCCTGAAGCAGTGGGATGG - Intronic
1126210434 15:46095125-46095147 CCTTCCTTGAAGCAGGGAGAAGG - Intergenic
1127509085 15:59622548-59622570 CCTCCTCTGAAGGAGGTAGAAGG + Exonic
1129064412 15:72889233-72889255 CCCACCTTGAAGCAGGTGAAAGG - Intergenic
1129241873 15:74256753-74256775 CCTTCCCAGAAGAGGGTAGAAGG + Intronic
1129254902 15:74328738-74328760 CCTGCCATGCAGCAGGTGGGAGG + Intronic
1129748193 15:78039553-78039575 ACTTCCTTGAGTCAGGTGGATGG - Intronic
1130821623 15:87502146-87502168 CCTGGCCTGGAGGAGGTGGAGGG - Intergenic
1131324839 15:91432235-91432257 TCTTCCCTGGAGAAGGTGGGTGG + Intergenic
1132106222 15:99064619-99064641 CCTTCCCTCAATCAGGAGAATGG - Intergenic
1132121484 15:99179727-99179749 CTCTCACAGAAGCAGGTGGAGGG + Intronic
1132157071 15:99503126-99503148 CCTCCCCCCAAGCAGATGGATGG - Intergenic
1132364557 15:101247761-101247783 CCATCCCTCAAGCAGATGGCAGG + Intronic
1132694722 16:1196796-1196818 CATCCCCTGATGCAGGTGGGTGG - Intronic
1134053364 16:11153168-11153190 CCATCCAGGAAGCAGGCGGAGGG - Intronic
1135678750 16:24439325-24439347 CCTGCCTTGGAGCAGGTGAAAGG - Intergenic
1137619799 16:49868661-49868683 CCTTGTCTGAAGCAGGAGGTGGG + Intergenic
1137844882 16:51677519-51677541 ACTTCCCAGAAAGAGGTGGAGGG - Intergenic
1138093225 16:54193566-54193588 CGTGCCCTGAGGCAGGGGGATGG + Intergenic
1138552685 16:57756086-57756108 GCCTGCCTGAAGCAGGGGGAGGG + Intronic
1138844997 16:60554580-60554602 CCATCCCTTAAGCAGAAGGAAGG + Intergenic
1140756781 16:78074741-78074763 CCTCACCTGAAGCAGGAGAAGGG + Intergenic
1141035439 16:80621825-80621847 CCTTGTCTTAGGCAGGTGGAGGG + Intronic
1141090327 16:81125867-81125889 CATGCCCTGAAGGTGGTGGAGGG + Intergenic
1141200178 16:81891678-81891700 CCTGTTGTGAAGCAGGTGGAGGG + Intronic
1142016771 16:87753031-87753053 CCTTCCCTGGAGCAGGGACAAGG + Intronic
1142178412 16:88655650-88655672 CCTTACCCGAAGCAGGGGGCTGG + Exonic
1142471026 17:163350-163372 CCTTCCCTAGAGAAGGGGGAAGG + Intronic
1142556001 17:777931-777953 CCTTCCCAGAGGTTGGTGGATGG - Intronic
1143354308 17:6314075-6314097 TCTCCCCTGCAGCAGGTGGGTGG - Intergenic
1144258674 17:13496348-13496370 CCCTGCCTGAAGAAGGCGGAGGG - Exonic
1144286915 17:13785792-13785814 GCTTCCCTGAAGGATGTGGTTGG + Intergenic
1144345478 17:14345476-14345498 CCCTGCCTGAAGAAGGCGGAGGG + Exonic
1145092416 17:19996840-19996862 ACTTGCCTGGAGCAGGCGGATGG - Intergenic
1145286215 17:21507597-21507619 CCCTCCCTGTACCAGGAGGAAGG - Intergenic
1145391393 17:22458719-22458741 CCCTCCCTGTACCAGGAGGAAGG + Intergenic
1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG + Intronic
1148872594 17:50667647-50667669 AGCTTCCTGAAGCAGGTGGAGGG + Exonic
1151329457 17:73398314-73398336 CATTACCTGTAGCAGGTGAAGGG + Exonic
1151351342 17:73533798-73533820 ACTTCCTTGAAGGAGCTGGAGGG - Intronic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1151654513 17:75489646-75489668 CCTTGCCTGGAGCTGGAGGAGGG - Exonic
1152292569 17:79448570-79448592 CCTCCCCTGAAGCCTTTGGAGGG + Intronic
1152418083 17:80175877-80175899 CCTGCCAGGAAGCAGGAGGAGGG - Intronic
1152581972 17:81169612-81169634 CCTCCCCTGGAGCATCTGGAGGG - Intergenic
1153131599 18:1860181-1860203 CCTTCCCTGAGGCAGTTGCCAGG - Intergenic
1154323464 18:13372660-13372682 CCTTCCCTGAAGCTGTGGAATGG + Intronic
1157306984 18:46524736-46524758 CTCTCCCTGAAGAAGGAGGATGG - Exonic
1157801870 18:50627426-50627448 CCACCCCTGAAGCTGGTGGTTGG - Intronic
1158524222 18:58197881-58197903 CCTTCCCTCAAGCAGGCTCAGGG - Intronic
1158548498 18:58415857-58415879 CCCTCCCTGGAGCAGGCTGAGGG - Intergenic
1159559415 18:69977654-69977676 CCTCCCCTGAAGCAGTTGCCAGG - Intergenic
1159731432 18:72033170-72033192 CCTCTCCTCAAGCAGATGGAAGG + Intergenic
1160187803 18:76688903-76688925 CCATCCCTGCTGCAGGTGGACGG - Intergenic
1160338546 18:78066075-78066097 CTCTCCCTGAAGAAGTTGGAGGG + Intergenic
1160425792 18:78778273-78778295 CCCTCCATGAAGCCGGAGGACGG + Intergenic
1160497782 18:79385290-79385312 CGTTCCCTCAAGCAGGTGATGGG + Intergenic
1160583964 18:79902712-79902734 TCTTCCCTTCCGCAGGTGGAGGG - Exonic
1160844866 19:1161791-1161813 GCCTCCCTGACGCAGGTGGTGGG + Intronic
1161234596 19:3191587-3191609 CCTTCCCTGAAGCCTGTTGATGG - Intronic
1161331000 19:3687820-3687842 CTTTCCCCGCAGCAGGTGGGCGG + Intronic
1161596280 19:5152561-5152583 CCTGCCCGGAAGCAGGCGAAAGG - Exonic
1161934740 19:7364709-7364731 CCTTCCCTGAAGCAGCCTGGAGG - Intronic
1162487023 19:10967257-10967279 CCTTCCCTGAGGGAATTGGAGGG - Intronic
1163481884 19:17561433-17561455 ACTTCCAAGAAGCAGGAGGAAGG + Intronic
1163497668 19:17656013-17656035 CCTTCCCTGGGGCAGCTGGCGGG + Exonic
1163718125 19:18884206-18884228 GCTTCCCTGGAGCAGGTAGGCGG + Exonic
1164497671 19:28783322-28783344 CCTCCCCTGAAGGGGGTGGTGGG + Intergenic
1165362959 19:35348022-35348044 CCTTTGCAGAAGCAGGTGAATGG - Intergenic
1165446810 19:35861107-35861129 CCTTCCCTGTCGCAGGTGCTGGG + Exonic
1166297868 19:41897510-41897532 CCTTCCCTGAGGCAGGGGGATGG - Intronic
1167288926 19:48614193-48614215 CCTCCACTGCAGCAGCTGGAAGG - Intronic
1168647018 19:58065975-58065997 CCTGCCATGAAGGAGGAGGAGGG + Intronic
1168720031 19:58549771-58549793 CCTGACCTGAAGGAGGAGGATGG + Exonic
925449533 2:3956969-3956991 CCTGCTCTGCAGCAGCTGGAGGG - Intergenic
925918754 2:8625273-8625295 CCTTCCCTGTGGCAGGTGGTTGG + Intergenic
926442016 2:12899499-12899521 CCCTATCTGAAGCAGGAGGATGG - Intergenic
927191082 2:20517364-20517386 CCTTTCCTGAAGAAGGCAGAGGG - Intergenic
928248415 2:29652630-29652652 CCTTCCCTGAGGCTGAGGGATGG - Intronic
928468102 2:31542157-31542179 CCTTTCCTTAAGCAGATGGTGGG - Intronic
929525106 2:42694163-42694185 CCATCCCTTAAGCAGAAGGAAGG + Intronic
930657712 2:54022744-54022766 CATTCACTGAAGCAGGTTGTAGG + Intronic
931300864 2:60976773-60976795 CCTTGCCAGAAGCAGGTCCAGGG - Intronic
931791325 2:65666616-65666638 CCACCCCAGAAGCTGGTGGAGGG - Intergenic
932439730 2:71726298-71726320 CCTACCCTCAAGGAGGAGGATGG - Intergenic
932575243 2:72959115-72959137 CCCTGCCTGAAGCAGGTCCATGG + Intronic
932858839 2:75267291-75267313 CCTTTCCTCAAGCCGTTGGAAGG + Intergenic
933526746 2:83450564-83450586 TCTTCCTTGAAACAGTTGGAAGG - Intergenic
934731283 2:96660022-96660044 CCTTCCCTGACCCAGGAGTAGGG + Intergenic
934942117 2:98510259-98510281 TCTTGCCTGGAGCAAGTGGAAGG + Intronic
934991861 2:98927220-98927242 CCCTCCCTGGTGCGGGTGGACGG + Intronic
935034880 2:99360048-99360070 ACTTCACTGAAGCAGATGTAGGG + Intronic
935863212 2:107356928-107356950 CCTTCCCTGGAGCAGGAGGAAGG - Intergenic
935925591 2:108065185-108065207 CTTTCCAGGAAGCAGCTGGATGG + Intergenic
936414532 2:112292635-112292657 CATTCCCTGATGAATGTGGAGGG - Intronic
937118159 2:119424333-119424355 CCTCCTCTGAAGCAAGTGGTGGG - Intergenic
937216188 2:120315129-120315151 CCATCCCAGAAGCCGCTGGAGGG - Intergenic
937257284 2:120564516-120564538 CCCTCCCTGTGGCAGGAGGATGG + Intergenic
937759405 2:125582309-125582331 TGTTCCCAGAAGCAGCTGGAAGG - Intergenic
939061076 2:137421741-137421763 CCTGCCTTGGAGCAGGTGAAAGG + Intronic
939086178 2:137721155-137721177 TCTTCCCAGAAAAAGGTGGAAGG - Intergenic
939894656 2:147776844-147776866 CTTTCCCTGAAGGAGGAGGTGGG - Intergenic
941346661 2:164377481-164377503 CCTGCCCAGAAGCAGGGGGATGG + Intergenic
941595388 2:167470596-167470618 TCTTTCCTGAAGCAGAAGGAGGG + Intergenic
941667674 2:168258684-168258706 CCTTCCCTGAGGCAGTTGCCAGG + Intergenic
942095792 2:172535590-172535612 CCTTCCATGAAGCTGGGGGGAGG - Intergenic
942564630 2:177254324-177254346 CCTAACCTGAAGCAGGTGATGGG - Intronic
943172269 2:184417275-184417297 ACTTTACTGAAGCAGGTTGAAGG + Intergenic
943201246 2:184827593-184827615 GCTTGCCTGAAGCAGATGGTTGG - Intronic
943509154 2:188802798-188802820 CCTTTCCTGAGGCAGTTGGCAGG + Intergenic
943701257 2:190990237-190990259 CGTTCAGTGGAGCAGGTGGATGG + Intronic
944510196 2:200456847-200456869 CCTTCCCTGAATCAACTAGAAGG - Intronic
945054588 2:205857407-205857429 CCTTCCCTAGAGCAGATGGCAGG + Intergenic
945316628 2:208377549-208377571 CCGTCCCAGAGGCAGGTGGGGGG - Intronic
946288110 2:218720881-218720903 CCTTCCCAGAAGGTGGGGGATGG - Intronic
946329693 2:219002221-219002243 CCCTCCCAGAGGCAGGTGGGTGG - Intergenic
946551689 2:220808310-220808332 TCTTCCCTGAAGCCTCTGGAAGG + Intergenic
947519325 2:230831771-230831793 CCATCCCTGCACCAGATGGAGGG + Intergenic
1168836126 20:878488-878510 TTTTCCCTCTAGCAGGTGGAGGG - Intronic
1169203557 20:3727891-3727913 CCTTCCTTGAAACAGCTGGAGGG - Intergenic
1170132970 20:13042659-13042681 CCTTGCCTGAAGCAGGGGACAGG + Intronic
1170940860 20:20846786-20846808 CCAGCCCTGAAGGAGGAGGAGGG - Intergenic
1171115798 20:22523909-22523931 CCTTCCCTGGAGCAGGCTGAAGG + Intergenic
1172649389 20:36492230-36492252 GCCTCCCTGAAGCAGGGAGATGG - Intronic
1172896242 20:38302234-38302256 CCTTACCTGAGGCAGGTGCCAGG - Intronic
1173638446 20:44581808-44581830 CCTTCCCTCAAGCATGTAGTTGG + Intronic
1174161910 20:48557120-48557142 CCTTCCCTGGAGGAAGGGGAGGG - Intergenic
1174240843 20:49133485-49133507 CCTTTCCTGAAACAGGTGCCGGG + Intronic
1174751050 20:53111896-53111918 CCATCCCTGACCCAGGTGGTGGG - Intronic
1175026697 20:55910170-55910192 CCTTTCCTGAAGCAGTTGTATGG + Intergenic
1175033880 20:55981534-55981556 CCTTCCCTGAAGAGGGTGGGAGG - Intergenic
1175348448 20:58300555-58300577 CCTTTCAAGAAGCAGCTGGAGGG - Intergenic
1178279093 21:31265598-31265620 TCTTCACTGCAGCAGGTGGGAGG - Intronic
1178498809 21:33109405-33109427 CCTTCCCCCAGGCAGGAGGAAGG + Intergenic
1178565881 21:33684207-33684229 CCTTCCTTAAAGCAGATGCATGG - Intronic
1179435698 21:41360689-41360711 CCTTCCTTGAAGCAGTAGGCCGG + Intergenic
1179614133 21:42570830-42570852 ACTGCCCCCAAGCAGGTGGAGGG + Intronic
1180017429 21:45096473-45096495 CCTGCCCTGAGGCTGTTGGAGGG + Intronic
1182660141 22:31919313-31919335 CCTTCCCTGAATCAGGAGAGAGG - Intergenic
1182695512 22:32196705-32196727 TCTTCCCTGGAGCAGCTGAAAGG - Intronic
1183437565 22:37804596-37804618 CTTTCCCTGAAAGAGTTGGAAGG - Intergenic
1183872265 22:40748803-40748825 CGTTCACTGAAGCATGTGGATGG + Intergenic
1184629076 22:45761954-45761976 TCTTAACTGAAGCAGGTGAATGG + Intronic
951108467 3:18772906-18772928 TCCTCCCAGAATCAGGTGGAAGG + Intergenic
951172195 3:19555142-19555164 CCTCCCCTCAAGCAGAAGGAAGG + Intergenic
951349784 3:21592925-21592947 GCTGCCCTGTAGCAGGTGTAGGG - Intronic
952707459 3:36393715-36393737 CCATCCATGAACCAGGAGGAAGG + Intronic
952945580 3:38476311-38476333 CACTTCCTGCAGCAGGTGGAAGG + Intronic
953071939 3:39529651-39529673 CTTTCCCCGAAGGAGGTGGCAGG + Intergenic
953083019 3:39638728-39638750 CCTTCCCAGAGGTAGGTGGGTGG + Intergenic
953797714 3:45997985-45998007 CCTGCCTTAAAGCAGGTGAAAGG + Intergenic
955202131 3:56861005-56861027 CTTTCCCTGCAGCAGGGGGCTGG - Intronic
955876267 3:63493088-63493110 CGTCCCCTCAAGCAGGTGGCTGG + Intronic
956665555 3:71638869-71638891 CCTTCCATATAGCAGGTGGCAGG - Intergenic
957041267 3:75337235-75337257 GATTCCCTGAACCAGGAGGAGGG + Intergenic
957132060 3:76235412-76235434 CCTTCCCTAAAGCCTTTGGAGGG + Intronic
957247862 3:77735826-77735848 CCTCCCCTGAAGCAGCTGCCAGG - Intergenic
957550529 3:81697786-81697808 CCTGCTTTGGAGCAGGTGGAAGG + Intronic
958454155 3:94309021-94309043 CCTGCCTTGAGGCAGGTGAAAGG - Intergenic
960055857 3:113275939-113275961 CCTCCCCAGAGGCAGGGGGACGG + Intronic
961046075 3:123708890-123708912 GATTCCCTGAACCAGGAGGAGGG + Exonic
961435375 3:126912905-126912927 CCTTCCCTGCAGAAGGCCGAGGG + Intronic
961464446 3:127072792-127072814 CCTGCCCTGAAGCTGGGTGAGGG + Intergenic
961509304 3:127391374-127391396 CCTTCCATGAAGCAGGTCTGAGG - Intergenic
962082938 3:132159810-132159832 CATTCCCAGAAGCAGGGGAAGGG - Intronic
963227233 3:142874651-142874673 TCTGCCCAGAAGCAGGTGGATGG + Intronic
963742238 3:149092296-149092318 ACTTCCCTGAAGCTGGGGAAAGG - Intergenic
964417553 3:156463452-156463474 CTTTGCCTGGAGGAGGTGGAGGG - Intronic
964725858 3:159814021-159814043 CCCTCCTGGAAGCGGGTGGAGGG - Intronic
965358647 3:167709820-167709842 CCTATCCTGAAGCAGAAGGAAGG - Intronic
966608371 3:181844304-181844326 CCTCCCCTCCAGCAGGTAGAGGG - Intergenic
969149641 4:5158426-5158448 TCTTTCTGGAAGCAGGTGGAGGG - Intronic
970089519 4:12388850-12388872 CCTCCCCTGAGGCAGGTGCCAGG - Intergenic
971255207 4:25008118-25008140 ACTTCCCTGAAGGAGGTAGAAGG - Intronic
972322975 4:37989806-37989828 CCTTCCCTGAAATAGGTGTAGGG + Intronic
972805642 4:42527541-42527563 CCTCCCCTGAAGCAGTTGCCAGG + Intronic
974975638 4:68887892-68887914 CCTCTCCTGAAGCAGTTGGCAGG - Intergenic
976922763 4:90458232-90458254 CACTCCATGGAGCAGGTGGAAGG - Intronic
977854753 4:101875995-101876017 CCTTTCCTAAAGCAGAGGGAAGG - Intronic
979413415 4:120406531-120406553 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
979923978 4:126536574-126536596 CCATCCATGAACCAGGTGGCAGG + Intergenic
982526877 4:156489919-156489941 CCTCCCCTGAGGCAGGTGCCTGG + Intergenic
982899572 4:160981199-160981221 TCTTCCCTTAAGCAGAAGGAAGG + Intergenic
983895244 4:173074491-173074513 TCTTCCCTAAAGCAGATGGATGG + Intergenic
985569836 5:638942-638964 CCAGCCCTGAGCCAGGTGGAGGG - Intronic
985728265 5:1526855-1526877 CCTTCTCTGCTGCAGCTGGAAGG + Intergenic
985820368 5:2156052-2156074 CCTGCCCTGGAGCCGCTGGAGGG - Intergenic
986838156 5:11665301-11665323 CTTTCAGTGAAGCAGCTGGATGG - Intronic
988581587 5:32473411-32473433 CCGTCCCTTAATCAGGGGGATGG + Intergenic
990255656 5:53966138-53966160 CCTTCCCTGAGGTTGGAGGATGG - Intronic
992604916 5:78445733-78445755 CCTTCCCTCAAGCATCTGAAAGG + Intronic
993267489 5:85744625-85744647 CCTTCCTTGAAGCAGAAGGAAGG + Intergenic
993294930 5:86124869-86124891 ACTTCCCTGAAGCAAGAGGTAGG - Intergenic
994274764 5:97822408-97822430 CCTTTCCTTAAGCAGAAGGAAGG + Intergenic
994343821 5:98662521-98662543 CCTCTCCTCAAGCAGGAGGAAGG - Intergenic
995269877 5:110207963-110207985 CCTTCCCTGAGGCAGCTGCCTGG - Intergenic
996358286 5:122620110-122620132 CCTTTCCTGAAGATGGAGGACGG + Intergenic
996574623 5:124967579-124967601 CCTTTCCTGAAGATGGAGGACGG + Intergenic
996779555 5:127171056-127171078 CCTTCCCAGAAACAGGATGAGGG - Intergenic
997430155 5:133832105-133832127 GCTTGTCTGAAGCTGGTGGAGGG + Intergenic
997804598 5:136904851-136904873 GCTTAGCTGAAGCAGGAGGATGG - Intergenic
998401591 5:141851448-141851470 CATGCCCTGAAGTAGGGGGATGG + Intergenic
999283825 5:150382285-150382307 CCCTCCCTGAAGCATGTGGTAGG + Intronic
999854530 5:155579822-155579844 CCTACCCTCAAGGAGGAGGATGG + Intergenic
1001746667 5:174098000-174098022 CCTTCCCAGCAGAAGGTGGCTGG + Intronic
1002465043 5:179404045-179404067 CCACCCCTGGAGCTGGTGGAGGG - Intergenic
1004518264 6:16339097-16339119 CCTTCCCTGCGGGATGTGGAAGG - Intronic
1005116682 6:22346338-22346360 CTATCCCTGGAGCAGATGGACGG - Intergenic
1005622794 6:27635489-27635511 CCTCCCCTGAAGCAGTTGCCAGG - Intergenic
1005761289 6:28970248-28970270 CCGCCCCAGAAGCTGGTGGAGGG + Intergenic
1006062019 6:31430661-31430683 CCTGCCCTGAAGCAGTTGCCAGG + Intergenic
1007476938 6:42125187-42125209 GCTTCTATGTAGCAGGTGGAGGG + Intronic
1007599921 6:43075416-43075438 CCTTCCCCCAAGCAGCTGGGAGG - Intergenic
1007717705 6:43866791-43866813 TCTTCTCTGTAGCAGCTGGAAGG - Intergenic
1007748688 6:44058823-44058845 CCTGCCCGGAGGCAGGGGGATGG + Intergenic
1007937921 6:45750387-45750409 CCTTCCCAGAGGCTGGTGGGTGG - Intergenic
1008164628 6:48120978-48121000 CCTTCCATGAAGGAGAAGGAAGG + Intergenic
1010203188 6:73300146-73300168 CCTTCCATGTAGCAGGTGTGTGG - Intronic
1010733145 6:79412091-79412113 CGTTCCCTGAAGAAAGGGGAAGG + Intergenic
1010786253 6:80004532-80004554 CCTAGCCTGACGCAGGAGGAGGG + Intronic
1011502522 6:88006846-88006868 CCATCCCGGCAGCAGGAGGAAGG + Intergenic
1012103351 6:95120626-95120648 CCTTCCTTGAAGCAGATCAAAGG - Intergenic
1012988883 6:105904524-105904546 CCATCCCTGATGGAGGAGGATGG + Intergenic
1013542289 6:111122569-111122591 CCTTACCTAAAGCAGGTGCTAGG - Intronic
1014069771 6:117167969-117167991 CATTCCCTGAAGGGTGTGGAAGG - Intergenic
1015553299 6:134434705-134434727 ATTTCCCTGAAGGAGGTGGGAGG + Intergenic
1018030036 6:159834359-159834381 CATTTCCTGTGGCAGGTGGAAGG + Intergenic
1018047176 6:159975527-159975549 CCTACCTTGGGGCAGGTGGAAGG + Intronic
1018123306 6:160658028-160658050 CCTTCCCTGAGGCAGCTGCCAGG - Intronic
1018398020 6:163395620-163395642 ACTTCCCTGAAGCATACGGAAGG - Intergenic
1018898855 6:168040953-168040975 AATTCCCTGCAGCAGGTGGTGGG + Intronic
1019644304 7:2120919-2120941 CCTGCCCTAGAGCAGGTGCAGGG - Intronic
1021222591 7:17990933-17990955 CCTGCCTTGGAGCAGGTGAAAGG + Intergenic
1021793168 7:24226914-24226936 ACTTCCCTGAAGCAGTGGGAGGG - Intergenic
1023965883 7:44962890-44962912 CCCTCCCTGCGGCAGGAGGAGGG + Exonic
1028266638 7:88733909-88733931 CCTTTCCTCAAGCAGAGGGAAGG + Intergenic
1028475670 7:91250618-91250640 CCTGCCCAGATGCAAGTGGAGGG - Intergenic
1028873260 7:95792389-95792411 CCTTCTCTGAAGCAAGTCAAAGG + Intronic
1029224027 7:99012056-99012078 CTCTCCCTCACGCAGGTGGATGG + Exonic
1030365155 7:108637393-108637415 ACTTCTCTCCAGCAGGTGGATGG + Intergenic
1030435460 7:109513843-109513865 TCTGCCCTGAAGGAGGTAGAAGG - Intergenic
1031231674 7:119114888-119114910 CCTCTCCTGAAGCAGAAGGAAGG + Intergenic
1031832685 7:126646596-126646618 CCTTCTCTTAAGCATGTGGGTGG - Intronic
1031914901 7:127553865-127553887 CCTTCACTGTAGGAAGTGGAAGG + Intergenic
1032127673 7:129206449-129206471 CCCTTCCTGCTGCAGGTGGATGG + Exonic
1032513884 7:132492999-132493021 CAGTACCTGAAGCAGGGGGAGGG + Intronic
1033059424 7:138091352-138091374 CTTTCCCTGATGAAGGAGGAGGG + Intronic
1034346171 7:150386638-150386660 CCCTCCCTGAGGCAGCAGGAAGG + Intronic
1036682388 8:10885151-10885173 GCCTCCCTGCGGCAGGTGGAGGG + Intergenic
1038601107 8:28943492-28943514 CCCTCCCTGTACCAGGAGGAAGG - Intronic
1039587477 8:38719327-38719349 CCTTGCCTGAAGCACCTGGGCGG - Intergenic
1040865883 8:52048642-52048664 CCTTCTCTGAGGCAGATGAAAGG + Intergenic
1041255672 8:55978123-55978145 CTGTCCCTGAAGCAGGTGTGAGG + Intronic
1042203715 8:66307125-66307147 CCTTCCTTGCAGCTGGTGAATGG + Intergenic
1043616428 8:82130722-82130744 CCTTCTCTGATGGAGGTGGCAGG - Intergenic
1044241415 8:89892850-89892872 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
1045733487 8:105267893-105267915 CCTCTCCTTAAGCAGATGGAAGG + Intronic
1046121803 8:109856548-109856570 CCTTCCCTGGAGGTTGTGGATGG + Intergenic
1047223577 8:122938344-122938366 CCTTCCCAGCTGCAGGTGGCTGG - Intronic
1047644914 8:126860269-126860291 GCTTACCTGAAGCTGGTGCATGG - Intergenic
1047653275 8:126947759-126947781 CTTTTCCTGAAGGATGTGGAGGG + Intergenic
1048867516 8:138771739-138771761 TCTTCTCTGAAGCCGTTGGAAGG - Intronic
1049255993 8:141614191-141614213 TCTTCCTTGGAGCAGGGGGAGGG + Intergenic
1050238871 9:3613234-3613256 CCTTTCCTCAAGCAGAAGGAAGG + Intergenic
1051686536 9:19663933-19663955 CCTTCTAATAAGCAGGTGGATGG + Intronic
1052713206 9:32082830-32082852 CCTTCCCAGATTCAAGTGGAGGG - Intergenic
1052796351 9:32927056-32927078 CCTTCCCTGAAAAAGCTGGCAGG + Intergenic
1053066927 9:35075515-35075537 CTGGCCCTGAAGCAGGTGGGTGG + Exonic
1055205314 9:73722754-73722776 CCTTCCCTGAGGCAGTTGCCAGG + Intergenic
1055739981 9:79377487-79377509 CCTGCCCTGCAGCTGGGGGAGGG - Intergenic
1056824051 9:89864559-89864581 CCTTCCCTGAAGAAGCCAGAGGG - Intergenic
1057717141 9:97503669-97503691 CCTACCCTGAAGGAGGGAGAAGG - Intronic
1057781773 9:98056457-98056479 CATTCCCTGCAGGAGGCGGACGG - Intergenic
1057906232 9:98985714-98985736 AAGTCCCTGAAGAAGGTGGATGG - Exonic
1060401665 9:123353246-123353268 CTTTCCAGGAAGCAGATGGAAGG + Intergenic
1060543993 9:124450022-124450044 CCTTCCTCGCAGCAGGTGGAAGG + Intergenic
1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG + Intronic
1061159351 9:128884208-128884230 CCTTGCCTGTAGGAGTTGGAGGG + Intronic
1061200121 9:129133178-129133200 CCTTCCCTGAGGCAGGCAGATGG + Intronic
1062261723 9:135666247-135666269 CCTTCCCGGGAGCTGGTGGAGGG - Intronic
1062526466 9:136979878-136979900 CCTTCCCTGAAGCAGAGGTGAGG + Intronic
1185816304 X:3159384-3159406 CTTTCCCTGAAGCAGGTCCTAGG + Intergenic
1186360588 X:8837018-8837040 CCTACACTGAAGCAGATGTAGGG + Intergenic
1186473497 X:9839002-9839024 CCTTCCCTGTCGCACGTGGAAGG + Intronic
1188180657 X:27051094-27051116 CCCGCCCTGAAGCAGCTGGTTGG + Intergenic
1190015049 X:46819600-46819622 CCTCTCCTCAAGCAGATGGAAGG - Intergenic
1190597886 X:52065248-52065270 CCTTCAGTGAAGCAGGAAGACGG - Intronic
1190610938 X:52188825-52188847 CCTTCAGTGAAGCAGGAAGACGG + Intronic
1190635973 X:52434302-52434324 CCTTCCCTGAAGGTTGTGGGTGG - Intergenic
1190952873 X:55163051-55163073 CATTCTCTGAGGAAGGTGGAGGG + Intronic
1192450996 X:71244789-71244811 CCTTCCCCGAACCATGAGGAAGG - Exonic
1192839237 X:74836693-74836715 CCTCCCCTTAAGCAGAAGGAAGG + Intronic
1193297181 X:79846924-79846946 CCTCTCCTGAAGCAGAAGGAAGG + Intergenic
1193455287 X:81724465-81724487 CCTTCCCTCAAGCTGAAGGAAGG - Intergenic
1193755957 X:85408827-85408849 CCTGCCCTCAAGCAGAAGGAAGG + Intergenic
1194646497 X:96464476-96464498 ATTTACCTGAAGCAGGAGGAAGG + Intergenic
1194795815 X:98210342-98210364 CCTTTCCTCAAGCAGAAGGAAGG - Intergenic
1195230537 X:102842484-102842506 CCATTCCTGAAGCAAGGGGAAGG + Intergenic
1195302518 X:103544583-103544605 CCTTTCCTGAAGCAGCTCAATGG - Intergenic
1196113208 X:111969416-111969438 CCTGCCCTGAAACAGAAGGATGG - Intronic
1196153971 X:112406743-112406765 CCTCTCCTCAAGCAGATGGAAGG - Intergenic
1196420458 X:115515522-115515544 CCTTCTCACCAGCAGGTGGATGG + Intergenic
1197426059 X:126298114-126298136 CCTCCCCTGAGGCAGTTGCAAGG - Intergenic
1197465414 X:126799063-126799085 CCTTTCCTCAAGCAGATGGAGGG - Intergenic
1197581320 X:128287989-128288011 CCTCTCCTGAAGCAGAAGGAAGG - Intergenic
1200073359 X:153539593-153539615 CCGTCCCTGCAGCAGATGGCAGG + Intronic
1201265151 Y:12199243-12199265 CTTTCCCTGAAGCAGGTCCTAGG - Intergenic
1201314933 Y:12634885-12634907 CCTCCCCTGAAGCAGATGCCTGG - Intergenic