ID: 1061084701

View in Genome Browser
Species Human (GRCh38)
Location 9:128392212-128392234
Sequence GGATTTGTTTTGTTTAGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 691
Summary {0: 1, 1: 0, 2: 7, 3: 65, 4: 618}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061084690_1061084701 30 Left 1061084690 9:128392159-128392181 CCGGAGGGGCTTGCGGGAGGGGT 0: 1
1: 0
2: 1
3: 14
4: 209
Right 1061084701 9:128392212-128392234 GGATTTGTTTTGTTTAGGTAGGG 0: 1
1: 0
2: 7
3: 65
4: 618

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061084701 Original CRISPR GGATTTGTTTTGTTTAGGTA GGG Intergenic
900736017 1:4300005-4300027 GGATTTGTTTTAATCAGGTTTGG + Intergenic
901015832 1:6229763-6229785 GTATTTTTTTTATTTATGTATGG - Intronic
901355822 1:8647706-8647728 GGTTTTGTTTTATTTTGGGAAGG + Intronic
902593351 1:17490779-17490801 TGTTTTGTTTTGTTTTGGGACGG - Intergenic
903078547 1:20790380-20790402 GGTTTTGTTTTGTTTTGAGATGG + Intergenic
904506096 1:30955479-30955501 TGTTTTGTTTTGTTTTGGTTTGG - Intronic
905084428 1:35358247-35358269 TGCTTTGTTTTGTTTTGGAATGG + Intronic
906349677 1:45047496-45047518 TTTTTTGTTTTGTTTTGGTATGG + Intronic
907233281 1:53021179-53021201 GTATTTTTTTTGTAGAGGTAGGG + Intronic
907834061 1:58092646-58092668 TGATTTGTTTATTTTAGTTACGG - Intronic
908116646 1:60947341-60947363 GCATCTGTTTTGTTTAGCCAGGG + Intronic
908230459 1:62099527-62099549 GGATTTTTTTTGTATGTGTAGGG + Intronic
908372139 1:63493498-63493520 GCATTTCTTTTGTTTAGAAATGG - Intronic
908657221 1:66401064-66401086 TGTTTTGTTTTGTTTTTGTAGGG + Intergenic
909006812 1:70286158-70286180 TGATTTGGTTTAATTAGGTAAGG - Intronic
909088006 1:71190672-71190694 GGAATTGATTTGTTTAGATGGGG + Intergenic
909590370 1:77341888-77341910 GTTTTTGTTTTGTTTTGGTTTGG + Intronic
910139898 1:84015670-84015692 GGATTTATTTTAATCAGGTATGG - Intergenic
910222647 1:84903976-84903998 TGATTTGTTTTGTTTTGTTTTGG + Intergenic
910579452 1:88806721-88806743 GGTTTTGTTTTGTTTTGAGACGG + Intronic
910841018 1:91561262-91561284 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
910969958 1:92845988-92846010 TGTTTTGTTTTGTTTTGGCAGGG - Intronic
911003976 1:93198973-93198995 GGGTTTGTTTTAATCAGGTATGG + Intronic
911138068 1:94464321-94464343 GGATTTTTTTTTTTTAAATATGG + Intronic
911872574 1:103117906-103117928 GGAAGTGTTTTGTTTAGCTGAGG + Intergenic
912384910 1:109266399-109266421 TGTTTTGTTTTGTTTTGGTTTGG + Intronic
912494548 1:110083154-110083176 GGATTTGATTTCTTAAGGTTTGG - Intergenic
912549164 1:110473489-110473511 GGGTTTGTTTTAATTAGGTATGG + Intergenic
912673440 1:111653280-111653302 GGATATGTTTTTTTTTGGGAGGG + Intronic
913380016 1:118200220-118200242 GGATTTTCTTTGTTTGGCTAAGG + Intergenic
914848595 1:151297128-151297150 TGTTTTGTTTTGTTTAGACAGGG + Intronic
915152874 1:153849031-153849053 TGTTTTGTTTTGTTTAGAGATGG + Intronic
915881771 1:159680075-159680097 TGTTTTGTTTTGTTTCGGTTTGG + Intergenic
916322397 1:163519714-163519736 GGTTTTGTTTTGTTTTGAGATGG - Intergenic
916708693 1:167381042-167381064 GGGTTTTCATTGTTTAGGTAAGG + Intronic
916770829 1:167906012-167906034 GGATTTGTTTTTTTAAGAAAAGG + Intronic
916814641 1:168339505-168339527 GGTTTTGTTTTGTTTTGGTTTGG - Intergenic
916912452 1:169365557-169365579 GAATTTTTTTTTTTTAAGTATGG + Intronic
917260782 1:173165657-173165679 GTATTTGATTTGTTTATGTCTGG + Intergenic
917965817 1:180177878-180177900 GGATATGTTTTGTTTTGTTTTGG + Intronic
918018108 1:180658566-180658588 GGTTTTGTTTTGTTTTGAGACGG + Intronic
918214362 1:182380312-182380334 TGTTTTGTTTTGTTTAGGCAAGG + Intergenic
918430393 1:184454088-184454110 GGATTTCTTTTGTTTACTTTTGG + Intronic
918493704 1:185110661-185110683 GGTTTTGTTTTGTTTTGAGACGG + Intergenic
918970427 1:191408764-191408786 AGATTTGTTTTCTTTAGAAAGGG - Intergenic
919144813 1:193620713-193620735 GGAATTGTTTAGTTTAAGGAAGG - Intergenic
919600957 1:199621665-199621687 GGATTTATTTTAGTTAGGTGTGG - Intergenic
920569745 1:207007714-207007736 GCATTTGTTTTGTTTGTTTATGG + Intronic
920591123 1:207220216-207220238 GCTTTTGTTTTGCTTTGGTAAGG + Intergenic
920671341 1:208005902-208005924 GGTTTTGTTTTGTTTTGAGATGG + Intergenic
921006354 1:211097331-211097353 GTATTTTTATTATTTAGGTAAGG + Intronic
921082774 1:211756244-211756266 GGATTTTTTTTGTTTTGGTTTGG - Intronic
921905313 1:220489549-220489571 GGATTTTTTTTTTTTAGGTTTGG - Intergenic
921931147 1:220755312-220755334 GGATTTGTTTTAATCAGGTATGG + Intronic
922708937 1:227812501-227812523 GGTTTTGTTTTGTTTTGGCCAGG - Intergenic
922879873 1:228972678-228972700 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
923272942 1:232373745-232373767 GGATTTGTTTTACTTAGGGATGG + Intergenic
923297081 1:232604580-232604602 GGTTTTGTTTTGGTTTGGTTTGG + Intergenic
923677901 1:236096091-236096113 AGATTTGTTTTAATTGGGTATGG - Intergenic
924062714 1:240192838-240192860 GGATTTTTTTTTTTTTGGTGTGG + Intronic
924467976 1:244315284-244315306 GGAATTGTTTTATTCAGGTACGG + Intergenic
924734104 1:246738846-246738868 GGTTTTGTTTTGTTTTGAGACGG - Intronic
924845915 1:247770654-247770676 TGTTTTGTTTTGTTTAGAGATGG - Intergenic
1063581674 10:7313651-7313673 TGTTTTGTTTTGTTTAGAGATGG + Intronic
1063787059 10:9396789-9396811 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1063995514 10:11614741-11614763 GGATTTTTTTTTTTTAAATAAGG + Intergenic
1064569528 10:16678159-16678181 GGGTTTGTTTTGTTTTGTTAGGG - Intronic
1064586771 10:16847036-16847058 GGCTTTGTTTTGGCTAGGAAAGG - Intronic
1064634548 10:17350514-17350536 TGTTTTGTTTTGTTGAGATAGGG - Intronic
1064939560 10:20718284-20718306 GGTTTTGTTTTGTGTATTTAGGG - Intergenic
1065980264 10:30887728-30887750 GGGTTTGTTTTAGTCAGGTATGG - Intronic
1066050145 10:31626904-31626926 GGAATTATTTTTTTTAGGTGTGG + Intergenic
1066240234 10:33526638-33526660 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1066589203 10:36974943-36974965 TGTTTTGTTTTGTTTTGCTAAGG - Intergenic
1067356085 10:45528436-45528458 GTATTTCTTTTGTTTAGTTGGGG + Intronic
1067407065 10:46032879-46032901 TGTTTTGTTTTGTTTGGGTTTGG + Intergenic
1067511486 10:46898526-46898548 GGAACTGTTCTGTTTAGGGAAGG + Intergenic
1067650760 10:48153338-48153360 GGAACTGTTCTGTTTAGGGAAGG - Intergenic
1067729676 10:48801127-48801149 GGATTAGATTTGTTTGAGTATGG - Intronic
1068582182 10:58754127-58754149 GGGTTTGTTTTGTTTTGCTTTGG + Intronic
1070290357 10:75109822-75109844 TGTTTTGTTTTGTTTAGACAGGG + Intronic
1070973951 10:80589963-80589985 GGATTTGTTTTATTTGGGTATGG + Intronic
1071321117 10:84459502-84459524 TGTTTTGTTTTGTTTTGGTTTGG + Intronic
1071993088 10:91119579-91119601 GGATTTTTCTAGTTTAGGTCTGG - Intergenic
1072023193 10:91426339-91426361 AGGTTTGTTTTGTTTGGTTAGGG - Intronic
1072263195 10:93702267-93702289 GGTTTTTTTTTGTTTTGGTTTGG - Intronic
1073545980 10:104349256-104349278 TGTTTTGTTTTGTTTTGGTGTGG - Intergenic
1074735970 10:116433164-116433186 GGTTTTGTTTTGTTTGGAAAAGG - Intronic
1074753566 10:116608976-116608998 TGTTTTGTTTTGTTTTGGTTTGG - Intronic
1074952747 10:118355652-118355674 GGATTATTTTTGTTTCGATAGGG - Intergenic
1075011224 10:118871790-118871812 GATTTTGTTTTAATTAGGTATGG - Intergenic
1075351326 10:121727397-121727419 TGTTTTGTTTTGTTTAGAGACGG + Intergenic
1076039281 10:127229217-127229239 GGTTTTGTTTTGTTTTGAGATGG - Intronic
1076039586 10:127233032-127233054 GGATTTGATTTGATTTGGCATGG + Intronic
1078353403 11:10614296-10614318 GCATTTGTTTTAATCAGGTATGG - Intronic
1078917450 11:15793162-15793184 GTTTTTGTTTTGTTTTGTTATGG + Intergenic
1079051141 11:17160815-17160837 GGTTTGGTTTTGTTAAGGCAGGG - Intronic
1080875455 11:36270612-36270634 GGATTTGTTTTAATCAGGAATGG - Intergenic
1080875594 11:36271613-36271635 GGATTTGTTTTAATCAGGAATGG - Intergenic
1081045249 11:38266240-38266262 GGATTTATTTCATTTATGTAAGG + Intergenic
1081068040 11:38572179-38572201 CATTTTGTTTTGTTTAGTTAGGG - Intergenic
1081149663 11:39611609-39611631 TGTTTTGTTTTGTTTTGGTCGGG - Intergenic
1081149665 11:39611614-39611636 GGTTTTGTTTTGTTTTGTTTTGG - Intergenic
1081165604 11:39805534-39805556 GGATTTGTGTTGTCTATGTTTGG - Intergenic
1081725040 11:45322074-45322096 GGATTTGTTTTAATCAGGTGTGG - Intergenic
1082852715 11:57779712-57779734 GGATTTTTTTTCTTGTGGTAGGG + Intronic
1082884728 11:58069893-58069915 TGTTTTGTTTTGTTTTGGTTTGG - Intronic
1085157291 11:74307442-74307464 GGGGTTGATTTGTTTAGGTCAGG + Intronic
1085714553 11:78860913-78860935 GGTTTTGTTTTGTTTTTGTAAGG - Intronic
1085922726 11:80978269-80978291 GGATTTATTTTGTTTTGTAAAGG + Intergenic
1087146654 11:94820063-94820085 TGATTTGTTTTGCTGAGGTAAGG - Intronic
1087257570 11:95973597-95973619 GGAGATATTTAGTTTAGGTATGG - Intergenic
1087417992 11:97883232-97883254 GGTTTTGTTTTGCTTATGTTGGG - Intergenic
1087776122 11:102258581-102258603 TGTTTTGTTTTGTTTTGATATGG + Intergenic
1087936419 11:104038467-104038489 GGTTTTGTTTTCTTTGGGAAGGG + Exonic
1088016523 11:105067411-105067433 GGAATTTTTTTTTTTATGTAAGG + Intronic
1088864477 11:113834572-113834594 GCTTTTGTTTTGTTTTGGTTTGG + Intronic
1089041565 11:115455650-115455672 AAAGTTGTTTTGTTTAGTTAGGG - Intronic
1089251948 11:117170564-117170586 AGATTTGTTTTGTTGGGTTAAGG - Exonic
1089392904 11:118114257-118114279 GGAATTGTTTTAATCAGGTATGG + Intronic
1089805754 11:121087195-121087217 TGTTTTGTTCTGTTTAGGTTTGG + Exonic
1089965485 11:122651893-122651915 TGTTTTGTTTTGTTTTGGGACGG + Intergenic
1090675660 11:128992781-128992803 TGTTTTGTTTTGTTTTGATACGG - Intronic
1090706061 11:129337986-129338008 GGATTCGTTTTGTTTTGAGACGG + Intergenic
1091077087 11:132629271-132629293 GGATTTGCTTTAATTAGATATGG - Intronic
1091425568 12:385513-385535 GAGTTTGTTTTGTTTTGGTTTGG - Intronic
1091759741 12:3078780-3078802 GGATTTTTTTTTTTTTGGTCTGG + Intronic
1092292857 12:7174201-7174223 GGTTTTATTATTTTTAGGTATGG - Intergenic
1092324517 12:7515713-7515735 GGGTTTGTTCTGTTTTGGTTTGG + Intergenic
1092868175 12:12782658-12782680 TGTTTTGTTTTGTTGAGGCAGGG - Intronic
1093158224 12:15714079-15714101 TGTTTTGTTTTGTTTTGGTTTGG - Intronic
1093174883 12:15901979-15902001 GGTTTTGTTTTGTTTTGAGATGG + Intronic
1093453776 12:19344282-19344304 TAATTATTTTTGTTTAGGTATGG - Intronic
1093613684 12:21194440-21194462 GGGGTTGTTTTGTTTTGCTAAGG + Intronic
1093633418 12:21436780-21436802 GGAGTTGTTTTGTAATGGTAAGG - Intergenic
1095730534 12:45501610-45501632 GGATTTGTTTGAATCAGGTATGG - Intergenic
1095881366 12:47140870-47140892 GGTTTTGTTTTGTTTTGCTCAGG - Intronic
1096245985 12:49986799-49986821 GCTTTTGTTTTGTTATGGTAGGG - Intronic
1096249503 12:50019929-50019951 GAGTTTCTTTTGTTTAGGTTTGG + Intronic
1097661225 12:62433805-62433827 TGTTTTGTTTTGTTTAGACAGGG - Intergenic
1097662256 12:62444066-62444088 GAATTTCTTTTGTTTAAGAATGG + Intergenic
1098072117 12:66687052-66687074 TGTTTTGTTTTGTTGAGATAGGG - Intronic
1098400885 12:70074509-70074531 GGATTTGTTTTAATTAGGAATGG + Intergenic
1098546036 12:71711892-71711914 GGTTTTGTTTTGTTTTGAGATGG - Intergenic
1098562661 12:71893119-71893141 GGTTTTTTTTTTTTTTGGTAAGG + Intronic
1098563065 12:71899952-71899974 GGTTTTGTTTTGTTTTGAGAAGG - Intronic
1098584347 12:72138395-72138417 TGCTTTGTTTTGTTTTGGTTTGG - Intronic
1098819361 12:75208918-75208940 GGATTTGTTTTTCTTGGGAAGGG - Intronic
1099409136 12:82302990-82303012 GGTTTTGTTTTGTTTTGAGATGG - Intronic
1099441252 12:82702440-82702462 GAATTTGTTTTATTAAGATACGG - Intronic
1099614152 12:84913079-84913101 GAATTTGTTTTGTTTTGCTTTGG - Intronic
1100273377 12:93047582-93047604 GGCTCAGTTTTGTTTGGGTAGGG - Intergenic
1100468731 12:94872596-94872618 TGTTTTGTTTTGTTTTGGTTTGG + Intergenic
1100661632 12:96705944-96705966 GAATTTTTTTTGTTTACGTAAGG + Intronic
1101057242 12:100930849-100930871 TGAGTTGTTTGGTATAGGTAGGG + Intronic
1101543785 12:105690352-105690374 GCATTTGTATTGTTTAGATTGGG - Intergenic
1101560690 12:105855065-105855087 GGTTTTGTTTTGTTTTGTTTTGG - Intergenic
1101684042 12:106999485-106999507 GGATTTGTTTTATTAAGGTAAGG + Intronic
1102032069 12:109745667-109745689 GGTTTTGTTTTGTTTTGTTTAGG + Intronic
1102403440 12:112651187-112651209 TGTTTTGTTTTTTTTAGGAACGG - Intronic
1102869785 12:116404900-116404922 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
1103774753 12:123358935-123358957 GGTTTTGTTTTGTTTTGAGATGG + Intronic
1104166524 12:126235967-126235989 GGTTTTGTTTTGTTTTGAGATGG + Intergenic
1104174618 12:126318023-126318045 TGTTTTGTTTTGTTTTTGTATGG + Intergenic
1104288784 12:127449460-127449482 GGATTTTTTTTTTTTGGGTGAGG - Intergenic
1104516046 12:129427768-129427790 GGTTTTGTTTTGTTTGGGTTTGG - Intronic
1105491023 13:20888351-20888373 GGTTTTGTTTTGTTTGGGGCAGG + Intronic
1105972857 13:25446860-25446882 TGTTTTGTTTTGTTGAGGCAAGG + Intronic
1106068321 13:26380488-26380510 GTATTTGTTTTTTTGAGATAGGG + Intronic
1106207039 13:27608801-27608823 TGTTTTGTTTTGTTTTGGTGGGG + Intronic
1106379019 13:29218129-29218151 TGTTTTGTTTTGTTTTGGTTTGG - Intronic
1106451380 13:29885856-29885878 TGTTTTGTTTTGTTTAGAGATGG - Intergenic
1106633109 13:31497915-31497937 GGATTTGTTTTAATCAGGTGTGG + Intergenic
1106666039 13:31851984-31852006 GGATTTGTTTTAACCAGGTATGG + Intergenic
1107126597 13:36853413-36853435 GGATGAGTTTTGTTAAGGTAAGG - Exonic
1107146668 13:37067734-37067756 GTTTGTGTTTTCTTTAGGTAAGG + Intergenic
1108528638 13:51307708-51307730 GGTTTTTTTTTGTTTTGGTTTGG + Intergenic
1110016819 13:70415955-70415977 GTTTTTGTTTTCTTTAGATAGGG - Intergenic
1110703284 13:78574796-78574818 GGCTTTGTTTTGTTTAAACAAGG + Intergenic
1111266997 13:85829433-85829455 GGGTTTTTTTTGTTTTGTTATGG - Intergenic
1111272579 13:85905627-85905649 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
1111287895 13:86119410-86119432 TGGTTTGTTTTGTTTTGGTTTGG - Intergenic
1111392347 13:87612656-87612678 TGTTTTGTTTTGTTTTGATATGG - Intergenic
1111462006 13:88557445-88557467 GGTTTTGTTTTGTTTTGTTTTGG + Intergenic
1111510583 13:89256696-89256718 GGATTTTTTTTTTTTTGGTCAGG - Intergenic
1111558176 13:89909091-89909113 TGTTTTGTTTTGTTTTGGCATGG + Intergenic
1112285907 13:98104356-98104378 GGATTTGTTTTAATCAGGTATGG + Intergenic
1112795239 13:103049839-103049861 TAATTTGTTTTGTTTAGGCTGGG + Intronic
1112969926 13:105248155-105248177 GGCTTTGTTTTGGTTTGGTTTGG - Intergenic
1115397358 14:32923284-32923306 TGTTTTGTTTTGTTTCGGGATGG - Intergenic
1115596792 14:34917252-34917274 GTATTTTTTTTTTTTAAGTAGGG - Intergenic
1115697512 14:35915386-35915408 GGTTTTGTTTTGGTTTGGTTTGG + Intronic
1116674001 14:47881334-47881356 GTTTTTGTTTTGTTTTGGTGTGG - Intergenic
1116875411 14:50106722-50106744 GGTTTTGTTTTTTTGAGATAGGG + Intergenic
1118455047 14:65937823-65937845 AGATTTGTTTTAATCAGGTATGG - Intergenic
1119003028 14:70900158-70900180 GTATTTTTTTTTTTTTGGTAGGG + Intergenic
1119051295 14:71371564-71371586 TGTTTTGTTTTGTTTTGGTTGGG + Intronic
1119189071 14:72667287-72667309 GGATTTGATTGTTCTAGGTAGGG + Intronic
1119455277 14:74749922-74749944 GTTTTTGTTTTTTTTAGGCAGGG + Intergenic
1119504864 14:75163795-75163817 GGATTTTTTTTTTTTAGATAGGG + Intronic
1120807968 14:88773651-88773673 TGATTTAATTTGTTTAGGTTGGG - Intronic
1120914028 14:89694673-89694695 GTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1121028149 14:90631971-90631993 GGTTTTGTTTCGTTTTGTTAGGG + Intronic
1121123633 14:91392288-91392310 GCTTTTGTTTTGTTTTGGCAGGG - Intronic
1122500594 14:102196500-102196522 GGGTTTTTATTGTTTAGGTAGGG + Intronic
1123045383 14:105510479-105510501 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
1125088773 15:35765829-35765851 AGATTTGTTTTGTTTTGTTTGGG + Intergenic
1125481496 15:40084243-40084265 TGTTTTGTTTTGTTTTGGTCAGG - Intergenic
1125987719 15:44071418-44071440 TGTTTTGTTTTGTTTAGACAGGG - Intronic
1126164639 15:45644523-45644545 GGATTTGTTTTAATCAAGTATGG + Intronic
1126453880 15:48840449-48840471 GGATTTGTTTTTGTTTGGTTTGG + Intronic
1129282163 15:74494235-74494257 GGTTTTGTTTTGTTTTGGTTTGG + Intergenic
1129371020 15:75095202-75095224 TGGTTTGTTTTGTTTTGGTTTGG - Intronic
1129756506 15:78102264-78102286 GTTTTTGTTTTGTTTTGGTTTGG - Intronic
1129969415 15:79764365-79764387 TGTTTTGTTTTGTTTTAGTAAGG + Intergenic
1130314363 15:82782407-82782429 TGTTTTGTTTTGTTTTGGTTTGG - Intronic
1130611389 15:85364440-85364462 GACTTTGTTTTGTTTAGAGATGG + Intergenic
1131933963 15:97480537-97480559 TGTTTTGTTTTGTTTTGTTATGG + Intergenic
1132030499 15:98434993-98435015 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
1132421791 15:101676276-101676298 TGTTTTGTTTTGTTTAAGCAGGG + Intronic
1133792649 16:9021067-9021089 GGTTTTGTTTAGTTTCTGTAGGG + Intergenic
1133793097 16:9024587-9024609 GGTTTTGTTTTGTTGAGACAGGG - Intergenic
1133897134 16:9940697-9940719 GGTTTTGTTTTGTTTTGTTTTGG - Intronic
1134852284 16:17489910-17489932 GGATTTGTTTTTTTAATATATGG - Intergenic
1135810526 16:25582622-25582644 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1136246327 16:28978280-28978302 GGGTTTGGAGTGTTTAGGTATGG - Intronic
1136457256 16:30387550-30387572 GGTTTTGTTTTGTTTTGGAGAGG - Intronic
1138842941 16:60531021-60531043 AGATTTGTTTCAATTAGGTATGG - Intergenic
1140153627 16:72399539-72399561 GGATTTTTTTTTTTTTGATATGG - Intergenic
1140399605 16:74660263-74660285 GGTTTTGTTTTGTTTTGAGATGG - Intronic
1140501188 16:75434905-75434927 GGGTTTGTTTTGTTTTGGTTTGG + Intronic
1140654842 16:77129757-77129779 TGTTTTGTTTTGTTTTGGTTCGG - Intergenic
1141057860 16:80835269-80835291 GGATTTGTTTTTTCTGGGTCTGG + Intergenic
1142571767 17:879252-879274 GGGTTTTTTTTGTTTTGGTTTGG + Intronic
1143529653 17:7495270-7495292 GGTTTTGTTTTGTTTTGAGATGG - Intronic
1143726609 17:8851490-8851512 TGTTTTGTTTTGTTTTGGGACGG - Intronic
1144046807 17:11461428-11461450 GGATTTGTTTTAATCAGGTATGG + Intronic
1144094280 17:11885772-11885794 AGTTTTGTTTTGTTTTGGAAAGG + Intronic
1144147400 17:12411803-12411825 GGATCTGTTTCAGTTAGGTATGG - Intergenic
1144790969 17:17859030-17859052 GGATTTGATTTGTAGAGGTGCGG + Intronic
1144805691 17:17965446-17965468 GGATTTGGTTTGTGTAGAAATGG - Intronic
1145067460 17:19771525-19771547 GCTTTTGTTTTGTTTTGGGAGGG - Intronic
1145215137 17:21045216-21045238 GGTTTTGTTTTGTTTAGAGATGG - Intergenic
1145751012 17:27354959-27354981 TGTTTTGTTTTGTTTAGACAGGG + Intergenic
1145917018 17:28580324-28580346 GGTTTTGTTTTGTTTTGTTTAGG - Intronic
1146415204 17:32625554-32625576 GGATTTTTTTTTTTTAAATAGGG + Intronic
1147638484 17:41978873-41978895 GGTTTTGTTTTGTTTTGAGACGG - Intronic
1147858854 17:43504349-43504371 GAATTATTTTTTTTTAGGTAGGG - Intronic
1147940175 17:44040974-44040996 GGTTTTGTTTTGTTTTGAGACGG - Intronic
1148368881 17:47078930-47078952 GGTTTTGTTTTGTTTTGTTTTGG + Intergenic
1148401505 17:47366205-47366227 GGATTTGCTTTATTAAGATATGG + Intronic
1148541267 17:48482516-48482538 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
1149862928 17:60134097-60134119 GGTTTTGTTTTGTTTTGAGATGG - Intergenic
1150767654 17:68014893-68014915 TAATGTGCTTTGTTTAGGTAGGG + Intergenic
1150777946 17:68096882-68096904 GTGTTTGTTTTTTTGAGGTAGGG + Intergenic
1151059891 17:71079854-71079876 GCTTTTGTTTTGTTTTGGTTTGG - Intergenic
1151781120 17:76246181-76246203 GTATTTGTTTTGTTAAAGAAAGG - Intergenic
1152761641 17:82111098-82111120 GTTTTTGTTTTGTTTTGGGACGG + Intronic
1152765277 17:82133888-82133910 GTTTTTGTTTTGTTTTGGTTTGG - Intronic
1153081972 18:1237912-1237934 GGATTTGTTTTAATCAGGCATGG - Intergenic
1153570333 18:6465888-6465910 GGTTTTGTTTTGGTTTGGTTTGG + Intergenic
1153932378 18:9889632-9889654 AGATTGGTTTTCTTGAGGTAAGG - Intergenic
1154150215 18:11900607-11900629 GGCTTATTTTTCTTTAGGTAAGG - Intronic
1154484658 18:14864356-14864378 GGGTTTTTTTTGTTTTGGTTTGG - Intergenic
1155270551 18:24137868-24137890 GGTTTTGTTTTATTTTGGTTTGG + Intergenic
1155302694 18:24446074-24446096 GGTTTTGTTTTATTTTGGTTTGG + Intronic
1156110259 18:33717727-33717749 GTTTTTGTTTTGTTTTGGTTTGG + Intronic
1156239309 18:35237282-35237304 GGATTTGTTTTTATCAGTTATGG - Intergenic
1156682900 18:39612564-39612586 GTTTTTGTTTTGTTTTGGTCTGG + Intergenic
1156735795 18:40257411-40257433 GAATTTGTTTTATTTCGGTATGG - Intergenic
1158330815 18:56360000-56360022 TTCTTTGTTTTGTTTAAGTAAGG - Intergenic
1158438101 18:57448388-57448410 AGGTTTGTTTTGTTTTGGGATGG - Intronic
1158573320 18:58614979-58615001 GGATTTTTTTTTTTTTTGTAGGG + Intronic
1158795000 18:60835016-60835038 GGTTTTGTTTTGTTTTAATAAGG + Intergenic
1159446795 18:68550871-68550893 GCCTTGGTTTTGTTCAGGTATGG - Intergenic
1159464149 18:68759002-68759024 GTTTTTGTTTTTTTTAGGTAGGG - Intronic
1159886580 18:73913457-73913479 TGTTTTGTTTTGTTTTGGTTTGG + Intergenic
1160141349 18:76326410-76326432 GAATTTTTTTTTTTTAGTTATGG - Intergenic
1160563790 18:79774521-79774543 GGTTTTGTTTTGTTTGGGACAGG + Intergenic
1161459336 19:4387303-4387325 GTTTTTGTTTTTTTTAGGCAGGG + Intronic
1162257427 19:9502190-9502212 TGTTTTGTTTTGTTTCGGTTTGG + Intergenic
1162313891 19:9925248-9925270 TGTTTTGTTTTGTTTAGACAGGG - Intronic
1162504031 19:11071850-11071872 GAATTTCTTTTGTAAAGGTAAGG - Intergenic
1162839905 19:13348828-13348850 GGTTTTGTTTTGTTTTGAGATGG - Intronic
1163610676 19:18299809-18299831 TCATTTGTTTTGTAGAGGTAGGG + Intergenic
1163840213 19:19603239-19603261 GGATTTGTTTTAATCAGGTATGG - Intronic
1164242114 19:23398496-23398518 TGTTTTGTTTTGTTTAGAAAAGG - Intergenic
1164802448 19:31088822-31088844 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1165854842 19:38873530-38873552 TGTTTTGTTTTGTTTTGGCAGGG + Intronic
1167180209 19:47897478-47897500 TGATTTTTTTTTTTTAGGTGGGG + Intergenic
1167894243 19:52568367-52568389 TGTTTTGTTTTGTTTTGGGAAGG - Intronic
1167926224 19:52823204-52823226 TGTTTTGTTTTGTTTTGGTTTGG + Intronic
1168040194 19:53752578-53752600 TGTTTTGTTTTGTTTAGTTTTGG + Intergenic
1168441370 19:56370421-56370443 GGATTTTTTTTGTTTTGTTTTGG + Intergenic
925166588 2:1719396-1719418 GGCTTTGTGTGGTTTATGTAAGG - Intronic
925508683 2:4599468-4599490 GGTTTTGTTTTGTTTTGGTTTGG - Intergenic
925661143 2:6204234-6204256 GTTTTTGTTTTGTTTGAGTAGGG - Intergenic
926314852 2:11702034-11702056 AGATTTGTTTTAATTGGGTATGG + Intronic
926866446 2:17364396-17364418 GAGTTGGTTTTGTTTGGGTATGG + Intergenic
927108748 2:19849336-19849358 GGATTTATTTTGTTTTGCTCAGG + Intergenic
928010110 2:27599552-27599574 GTTTTTGTTTTGTTTTTGTATGG + Intronic
928522073 2:32099453-32099475 TGTTTTGTTTTCTTTGGGTAGGG + Intronic
928651822 2:33411844-33411866 TGTTTTGTTTTGTTTTGGTCTGG + Intergenic
929035171 2:37683741-37683763 GGATTTGTTTTAATCAGGTATGG - Intronic
929125586 2:38520275-38520297 GGTTTTGTTTTGTTTTGAGACGG + Intergenic
929502499 2:42502373-42502395 GGATGTGTTTGGTGGAGGTACGG + Intronic
929738167 2:44574090-44574112 GGATTTGTTTTAATCAGGTTTGG + Intronic
930232378 2:48856517-48856539 GGATTTGTTTTACTCAGGTATGG + Intergenic
930653384 2:53984772-53984794 GGTTTTGTTTTGTTTTGTTTTGG - Intronic
931717720 2:65042472-65042494 TTATTTGTTTTGTTTAGAGAGGG - Intergenic
932297925 2:70642214-70642236 GGTTTTGTTTTGTTTAAAAATGG + Intronic
933661607 2:84931969-84931991 GGATTTGTCTTAATTAGGTGTGG - Intergenic
933757890 2:85654636-85654658 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
933766802 2:85714749-85714771 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
933839596 2:86275804-86275826 GGATTTGTTTTACTCAGGGATGG - Intronic
934101002 2:88652786-88652808 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
935092341 2:99907643-99907665 TGTTTTGTTTTTTTTAGATAGGG + Intronic
935705362 2:105851902-105851924 GGTTTTGTTTTGTTTTGGTTTGG + Intronic
935735240 2:106101331-106101353 GGATTTGCTTTTTTTGGGTGTGG + Intronic
936636402 2:114263834-114263856 GGTTTTGTTTTGTTTTGGTTTGG - Intergenic
936808935 2:116372424-116372446 TGCTTTGTTTTGTTTTGGGAAGG + Intergenic
937052994 2:118907520-118907542 GGATTTGTTTTAATTTGGCAAGG + Intergenic
937595155 2:123663298-123663320 CGTTTTGTTTTGTTTGGTTAAGG - Intergenic
937928251 2:127184416-127184438 GTTTTTGTTTTTTTTAGATACGG + Exonic
938027780 2:127965289-127965311 CGTTTTGTTTTGTTTAGAGACGG - Intronic
938574331 2:132589865-132589887 GCATTTGTTTTATTAAGGGAAGG + Intronic
938908605 2:135863720-135863742 TGTTTTGTTTTGTTTTGTTAGGG - Intronic
939169524 2:138678484-138678506 GGATTTTTTTTTTTTAAGTCAGG + Intronic
939533955 2:143401194-143401216 GTCTTTGTTTTGTTTAGGTGGGG + Intronic
939794694 2:146627927-146627949 GGGTTTTTTTTGTTAAGATAAGG - Intergenic
939798264 2:146675330-146675352 GATTTTGTTTTGTTTTGGTTTGG - Intergenic
939982719 2:148799964-148799986 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
939984356 2:148815278-148815300 GGATTTGTTCTGATCAGGTCTGG - Intergenic
940063935 2:149605399-149605421 GGTTTTGTTTTGTTTTGTTTAGG + Intergenic
940434821 2:153639068-153639090 TGTTTTGTTTTGTTTTGGTCAGG + Intergenic
941047028 2:160687908-160687930 GGATTTCTGTTGTTAAGTTATGG + Intergenic
941290636 2:163669214-163669236 CGTTTTGTTTTGTTTAAGAAAGG + Intronic
942641262 2:178063353-178063375 GGATTTGTTTTAATGGGGTATGG + Intronic
942648162 2:178137025-178137047 GGGGTTGTTTTGTTTTGGCAGGG + Intronic
943213527 2:185000445-185000467 GGACTAGTTATGTTTAGTTAAGG - Intergenic
943218402 2:185070732-185070754 TGTTTTGTTTTTTTGAGGTAGGG + Intergenic
943782892 2:191844808-191844830 GGTTTTGTTTTGTTTTGTCATGG - Intronic
944240794 2:197483212-197483234 GGTTTTGTTTTGTTTCGAGACGG - Intergenic
944447176 2:199803444-199803466 TGTTTTGTTTTGTTTTGGTTTGG + Intronic
945040283 2:205738375-205738397 TGCTTTGTTTTGTTTTGGAAAGG - Intronic
945191137 2:207188722-207188744 AGATTTGTTTTGTTTTGTTTAGG + Intergenic
945219299 2:207467845-207467867 GGATTTTTTTTTTTTTGGGAGGG - Intergenic
945513168 2:210727777-210727799 TGTTTTGTTTTGTTTTGGTTTGG + Intergenic
946069665 2:217022754-217022776 GGATTCTTTTTGTTGAGGAATGG - Intergenic
947048937 2:226020384-226020406 GTGTTTGTTTTGTTTTGGGATGG - Intergenic
947721718 2:232373699-232373721 TGTTTTGTTTTGTTTTGGCAGGG + Intergenic
948435334 2:237949727-237949749 TGTTTTGTTTTGTTTTGGTTTGG + Intergenic
948590430 2:239046209-239046231 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
1168872457 20:1142220-1142242 TGTTTTGTTTTGTTTTGGGAAGG - Intronic
1170213088 20:13864642-13864664 GTATCTGTTTTGTTTTGGTTTGG + Intronic
1170751130 20:19146484-19146506 GGTTTTGTTCTTTTTTGGTAAGG + Intergenic
1170844739 20:19952848-19952870 GGTTTGGTTTTGTTTTGCTAGGG - Intronic
1172322727 20:34009199-34009221 GGATTTGTTTTGTTTTGTTTTGG + Intronic
1172713114 20:36942481-36942503 GGGGTTGTTTTGTTTAGCAAAGG + Intronic
1173604332 20:44320094-44320116 GCATTTGTCTTATTTGGGTATGG - Intergenic
1173610214 20:44361682-44361704 GGTTTTGTTTTGTTTTGGTTTGG - Intronic
1173744049 20:45423036-45423058 AAATTTTTTTTGTATAGGTAGGG - Intronic
1173796154 20:45861571-45861593 GGATTTGTTTTGTTTGTTTTAGG + Intronic
1174077825 20:47950908-47950930 GGATTTGTTTTAATCAGGTATGG + Intergenic
1174781259 20:53391139-53391161 TGTTTTGTTTTGTTTTGGTTTGG + Intronic
1174791623 20:53483520-53483542 TGTTTTGTTTTGTTTGGGGATGG - Intronic
1175234505 20:57500859-57500881 GGTTTTGTTTTGTTTTTGTTTGG - Intronic
1176666288 21:9690366-9690388 GGATTTGTTTAATTCAGGTATGG - Intergenic
1177695637 21:24566935-24566957 GAATTTACTTTATTTAGGTATGG - Intergenic
1180245122 21:46541952-46541974 GGTTTTGTTTTGTTTTGAGACGG + Intronic
1182378007 22:29862540-29862562 GGTTTTGTTTTGGTTTGGTTTGG - Intergenic
1182957490 22:34440688-34440710 GGTTTTGTTTTGGTTTGGTTTGG - Intergenic
1183690659 22:39386372-39386394 TGTTTTGTTTTGTTTAGACACGG - Intergenic
1184664957 22:45983438-45983460 GGATGTGTTTTGTGTGGGAACGG + Intergenic
949908609 3:8881047-8881069 GGATTTGGTTTGGTTTGGTTTGG - Exonic
950210965 3:11122868-11122890 GGATTTATTTGTTTTAGGTGTGG - Intergenic
950529134 3:13542970-13542992 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
951077875 3:18418873-18418895 GGTTTTGTTTTGTTTTGTTTTGG - Intronic
951823421 3:26840143-26840165 GGAATTGATTTGATTAGGTCTGG - Intergenic
951839815 3:27022469-27022491 GGATTTGTTTTAATCAGATATGG + Intergenic
953424742 3:42785315-42785337 GCATTCTTTTTCTTTAGGTATGG - Exonic
953781343 3:45873739-45873761 GGTTTTGTTTTGGTTTGGTTTGG - Intronic
954097652 3:48342120-48342142 TGTTTTGTTTTGTTTTGCTATGG + Intergenic
954119441 3:48487907-48487929 TGTTTTGTTTTGTTTTGGTTTGG - Intronic
954659003 3:52216512-52216534 GGTTTTGTTTTGTTTTGAGATGG - Intergenic
954981311 3:54748010-54748032 GAATTTGTTTTGTTTACCCATGG + Intronic
955738921 3:62068644-62068666 GTTTTTGTTTTGTTTTGGTTTGG + Intronic
955985947 3:64574336-64574358 GGATTTTTTTTGTATCGATAAGG + Intronic
956120108 3:65957770-65957792 TGTTTTGTTTTGTTTTGGGATGG + Intronic
956594763 3:70954868-70954890 TGTTTTGTTTTGTTTTGATAAGG - Intronic
957135733 3:76286681-76286703 GGTGTTGTTTTGTTTTGGAAAGG + Intronic
957142677 3:76381983-76382005 TGTTTTGTTTTGTTTTGATAAGG + Intronic
957518773 3:81291820-81291842 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
957837852 3:85622188-85622210 GGATTTGTTTTTTTTCTGGAAGG + Intronic
959237849 3:103747513-103747535 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
959418754 3:106108555-106108577 CCAGTTGTTTTGTTAAGGTATGG + Intergenic
959773658 3:110130936-110130958 GTTTTTGTTTTGTTTAGGATAGG - Intergenic
960003351 3:112755873-112755895 GGTTTTGGTTTGCTTATGTAGGG - Intronic
960120707 3:113946892-113946914 GGGTTTGTTTTGTTTTGGTAAGG + Exonic
960585900 3:119321651-119321673 GGTTTTGTTTTGTTTTGAGACGG + Intronic
960893560 3:122477672-122477694 GGATTTGTTTTTTTGAGACAAGG - Intronic
961179837 3:124867853-124867875 GGATTTGTTGTGTGTTGATATGG + Intronic
962017917 3:131462103-131462125 TGTTTTGTTCTGTTTAGGCAGGG - Intergenic
962044321 3:131739522-131739544 GGATTTGTTTTAATCAGGTATGG - Intronic
962470958 3:135708216-135708238 GGATTTTTTTTGTTGAGACAGGG + Intergenic
963319289 3:143795728-143795750 GGATTTGTTTTGTTTTGTTTTGG - Intronic
964600153 3:158491438-158491460 TGCTTTGTTTTGTTTTGGTTTGG + Intronic
964645580 3:158955681-158955703 GGATTTGTTTTGGATTGGTCGGG + Intergenic
964846440 3:161049288-161049310 TGTTTTGTTTTGTTTTGGTTTGG - Intronic
965010662 3:163084924-163084946 TGTTTTGTTTTGTTTTAGTAAGG + Intergenic
965679519 3:171235750-171235772 TGTTTTGTTTTGTTTTGGTGGGG + Intronic
967133740 3:186495905-186495927 CGTTTTGTTTTGTTTAGACAGGG - Intergenic
967384265 3:188895545-188895567 TGTTTTGTTTTGTTTTGATACGG - Intergenic
967759350 3:193206041-193206063 GGATTTGTTTTGATTACGTATGG + Intergenic
968245967 3:197148063-197148085 GGAATTGTTTTGTTTATTTTTGG - Intronic
968429413 4:546874-546896 GGGTTTTTTTTGTAGAGGTAAGG + Intergenic
968967995 4:3779011-3779033 TGTTTTGTTTTGTTTTGGTTTGG + Intergenic
969061896 4:4442610-4442632 TGTTTTGTTTTGTTTTGATACGG - Intronic
969277351 4:6145485-6145507 GTAATTTTTTTTTTTAGGTATGG - Intronic
969277576 4:6147289-6147311 TGTTTTGTTTTGTTTTGGTTTGG + Intronic
970376942 4:15468337-15468359 GGATTTGTTTTAATTAGGTATGG + Intergenic
970468254 4:16349452-16349474 GGGTTTTTTTTGTTTTGGTTTGG - Intergenic
970876841 4:20881050-20881072 TGTTTTGTTTTGTTTTGGTTTGG + Intronic
971071601 4:23099837-23099859 TGTTTTGTTTTGTTTTGGTGAGG + Intergenic
971145220 4:23968906-23968928 TGTTTTGTTTTGTTTTGGGATGG - Intergenic
971299976 4:25433958-25433980 AGATTTGTTTTGTTTAGTAGTGG + Intergenic
971737574 4:30475403-30475425 GCATTTCTTTTGTTTTGGTTTGG - Intergenic
971843609 4:31889554-31889576 GCATTTTTTTTTTTTAGGTTTGG - Intergenic
972497146 4:39644702-39644724 GGATTTTTTTTGTTTTGGTTTGG + Intergenic
972551315 4:40137582-40137604 GAATTTGTTTTAATCAGGTATGG + Intronic
973138733 4:46739338-46739360 TGTTTTGTTTTGTTTTGGTTTGG - Intronic
973676286 4:53267093-53267115 CGATTTCTTTTTTTTAGCTAAGG + Intronic
975094207 4:70438444-70438466 TGTTTTGTTTTGTTTTGGTTTGG + Intronic
975497058 4:75046564-75046586 GGATTTGGGTTGTTTTGTTAGGG + Exonic
975691556 4:76969527-76969549 AGATTTATTTTATTTAGTTAGGG - Intronic
977063984 4:92289985-92290007 GTTTTTGTTTTGTTTTGGTTTGG + Intergenic
977423086 4:96828403-96828425 GTATTTTTTTTTTTTAGATATGG + Intergenic
977889081 4:102286734-102286756 TGATTTGTTTTATTTTGCTATGG - Intronic
978733200 4:112055401-112055423 TGTTTTGTTTTGTTTTGGTTTGG + Intergenic
978792524 4:112677636-112677658 AGATTTGTGTTGTTTATGAAGGG - Intergenic
978832592 4:113106690-113106712 TGTTTTGTTTTGTTTGGGAAAGG + Intronic
979987909 4:127338013-127338035 AGTTTTGTGTTGTTAAGGTAGGG - Intergenic
980565202 4:134530751-134530773 TGTTTTGTTATGTTTAGTTAAGG + Intergenic
980606949 4:135104861-135104883 TGATTTGTTGTGTTGAGATATGG - Intergenic
981584990 4:146290874-146290896 TGTTTTGTTTTGTTTTGGTTTGG - Intronic
982201230 4:152963006-152963028 TGATTTGTCTTCTTTAGGGAGGG + Exonic
982304661 4:153917995-153918017 GGATTTTCATTGTTTAGGTTGGG - Intergenic
982885464 4:160774726-160774748 GTTTTTCCTTTGTTTAGGTAGGG + Intergenic
982984145 4:162183390-162183412 GCATTTGTTTTATTTGGGTATGG + Intergenic
982998285 4:162379813-162379835 TGCTTTGTTTTGTTTAGTTGGGG - Intergenic
983019640 4:162659702-162659724 GGATTTGTTTTATTCAGGTGTGG + Intergenic
983144873 4:164201223-164201245 TGTTTTGTTTTGTTTTGGGATGG + Intronic
983880829 4:172930686-172930708 GGTTTTGTTTTGTTAAGACAGGG + Intronic
985408733 4:189661970-189661992 GGATTTGTTTAATTCAGGTATGG + Intergenic
985746288 5:1650384-1650406 GGATTTTGTTTGTTTTGTTATGG - Intergenic
986008417 5:3687702-3687724 GATTTTGTTTTGTTTTGGTATGG + Intergenic
986097434 5:4573658-4573680 GTTTTTGTTTTGTTTTGGTTTGG + Intergenic
986623351 5:9700096-9700118 GGATTAGCTTTGTTTGTGTAAGG - Intronic
986872588 5:12067548-12067570 GGTTTTGTTTTGTTTTAGAAAGG + Intergenic
987431120 5:17834551-17834573 GGTTTTGTTTTGTGTAGGGATGG - Intergenic
987865337 5:23528766-23528788 AGATTTGATTTTTTTAGATAAGG + Intergenic
987879727 5:23727918-23727940 GGTTTTGTTTTGTTTTGAGATGG + Intergenic
988075799 5:26352522-26352544 GGATTTTTTTTTTTTTGGTGGGG - Intergenic
988130681 5:27100429-27100451 AGTTTTGTTTTCCTTAGGTACGG + Intronic
988276236 5:29084073-29084095 GTTTTTGTTTTGTTTATGGATGG + Intergenic
988492403 5:31716272-31716294 GGATCTGTTTTAATCAGGTATGG + Intronic
988559190 5:32264965-32264987 GGATTTTTTTTTTTTTGGTGGGG - Intronic
988655600 5:33208337-33208359 GGTTTTGTTTTGTTTTGAGATGG + Intergenic
989256563 5:39372114-39372136 TGTTTTGTTTTGTTTATGTTGGG - Exonic
989298188 5:39855021-39855043 GGTTTTGGTTTCTTTAGTTAAGG - Intergenic
989413498 5:41147347-41147369 GGAATTGCTTTGTTTAGACATGG + Intronic
989801209 5:45542714-45542736 GGATTTCTACTGTTTAGGTTAGG + Intronic
990021333 5:51130654-51130676 TGTTTTTGTTTGTTTAGGTATGG + Intergenic
990432972 5:55755351-55755373 ATATTTGTTTTGTTCAGGAATGG + Intronic
990442996 5:55865535-55865557 TGTTTTGTTTTGTTTAGGTTTGG - Intronic
990629689 5:57654403-57654425 TGTTTTGTTTTGTTTAGATGAGG + Intergenic
990858809 5:60302835-60302857 TGTTTTGTTTTGTTTAGACAGGG + Intronic
991980532 5:72225777-72225799 AGATTTTTTTTTTTTTGGTAAGG + Intronic
992045616 5:72885721-72885743 GGTTTTGTTTTGGTTTGGTTTGG + Intronic
992519616 5:77537242-77537264 GGATTTATTTTCATTAGGTATGG + Intronic
992738995 5:79754265-79754287 GTATCTGCTTAGTTTAGGTAGGG - Intronic
993029231 5:82685173-82685195 TGATTGCTTTAGTTTAGGTATGG + Intergenic
993070109 5:83150926-83150948 GGTTTTGTTTTGTTTTGTTTTGG + Intronic
993719360 5:91307078-91307100 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
993982162 5:94556219-94556241 GTTTTTGTTTTGTTTTGGTTTGG + Intronic
994152508 5:96464107-96464129 GGTTTTGTTTTGTTTTGGTTTGG + Intergenic
994172535 5:96673468-96673490 GCATTTGCCTTATTTAGGTATGG + Intronic
994195104 5:96914262-96914284 TGATTTGCTTTGTTTATGTCAGG + Intronic
994634854 5:102332110-102332132 GGATTTGTTTTGCTTATGACTGG + Intergenic
994985833 5:106932628-106932650 GTGTTTGTTTTGTTTTGGTTTGG + Intergenic
995002421 5:107150223-107150245 GGTTTTGTTTTGCTTTGGTTGGG + Intergenic
995604184 5:113833782-113833804 GGTTTTGTTTTGTTTTGAGATGG + Intergenic
996089142 5:119333779-119333801 TGTTTTGTTTTGTTTTGCTATGG + Intronic
996251393 5:121337845-121337867 GGTTTTGTTTTGTTTTTGTTTGG + Intergenic
996281652 5:121736776-121736798 TGTTTTGTTTTGTTTTGGGACGG - Intergenic
996437563 5:123452412-123452434 TGATTTGTTTTTTTTAGTTATGG - Intergenic
996767849 5:127052721-127052743 TGTTTTGTTTTGTTTTTGTAAGG - Intronic
997561318 5:134848304-134848326 TGTTTTGTTTTGTTTTGATATGG - Intronic
997654354 5:135544431-135544453 GGTTTTGTTTTGTTTTGTTTTGG - Intergenic
998030220 5:138860504-138860526 TGTTTTGTTTTGTTTTGATACGG + Intronic
998821931 5:146065028-146065050 GGTTTTGTTTTGTTTTATTAAGG - Intronic
998934156 5:147216410-147216432 GGAGTTTTTTTGTTTTGGTTTGG + Intergenic
999045774 5:148468031-148468053 GGATATGTTTGGTACAGGTAGGG + Intronic
1000183786 5:158839382-158839404 GTTTTTGTTTTGTTTTGGTGGGG + Intronic
1000423241 5:161061126-161061148 GGATTTTTCTTTTTTATGTAAGG - Intergenic
1000524383 5:162338031-162338053 TGAAATGTTTTGTTTAGATAAGG - Intergenic
1001352887 5:170988285-170988307 TGATTTTTTTTTTTTAAGTAAGG + Intronic
1001539423 5:172526954-172526976 GGATTTGTCTAAATTAGGTATGG + Intergenic
1001977136 5:176009412-176009434 GGGTTTGTTTTAATCAGGTATGG - Intronic
1002240291 5:177834368-177834390 GGGTTTGTTTTAATCAGGTATGG + Intergenic
1002532269 5:179854617-179854639 GGTTTTGTTTTGTTTGGATTTGG - Intronic
1003874998 6:10427147-10427169 GGTTTGGTTTTGTTTTGGTTTGG + Intergenic
1004492898 6:16133800-16133822 GGAGACGTTTTGCTTAGGTAAGG + Intronic
1005149400 6:22731554-22731576 GGTTTTGTTTTGTTTTGTTTTGG - Intergenic
1005585727 6:27274614-27274636 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
1006931855 6:37693535-37693557 GGGTTTGTTGTGTTTTTGTAAGG + Intronic
1007010183 6:38409243-38409265 GGTTTTGTTTTGTTTTGAGATGG - Intronic
1007302091 6:40875246-40875268 GGCTAAGTTTTGTTTAGGGATGG - Intergenic
1008438632 6:51506468-51506490 GTATTTGTTCTTTTTACGTAAGG - Intergenic
1008446928 6:51603306-51603328 TGCTTTATTTTGTTTAGGAAAGG - Intergenic
1008761041 6:54851457-54851479 TGTTTTGTTTTGTTTTGGTTTGG + Intronic
1008913037 6:56757193-56757215 GGATTTATTTTTTTCAGGAAAGG + Intronic
1008945197 6:57089811-57089833 GTATTTGTTTGGTTTTGGTATGG - Intronic
1009219164 6:60962801-60962823 GGATTTGTTTTCTTTCTCTAGGG + Intergenic
1009674941 6:66806772-66806794 TGTTTTGTTTTGTTTAAGTAAGG + Intergenic
1010194987 6:73230197-73230219 GGTTTTGTTTTGGTTTGGTTTGG + Intronic
1010258903 6:73792840-73792862 AAATTTGTTTTTTTCAGGTAGGG + Intronic
1011044236 6:83064607-83064629 GTTTTTGTTTTATTTTGGTAGGG + Intronic
1011079825 6:83477353-83477375 GGTTTGGTTTTGTTTATGTGGGG + Intergenic
1011924208 6:92622346-92622368 ACATTTGTTTTGTTTACTTAAGG - Intergenic
1012374558 6:98546002-98546024 GGATTTTTTTTTTTTACCTAAGG + Intergenic
1012613708 6:101248971-101248993 TGTTTTGTTTTGTTTTGGTTTGG + Intergenic
1013674113 6:112437917-112437939 GGTTTTGTTTTGTTTTGGCAGGG - Intergenic
1013837822 6:114353522-114353544 GGATTTTTTTTTTTTTGGTGAGG - Intergenic
1013918808 6:115375056-115375078 GGATTTCTATTGTTCAGTTATGG + Intergenic
1014042231 6:116841497-116841519 GGATTTGTTTTAATCAGATATGG - Intergenic
1014171902 6:118288010-118288032 GGTTTTTTTTTTTTTTGGTATGG + Intronic
1014701536 6:124694930-124694952 GGTTTTGTTTTCTTTTGTTATGG + Intronic
1015256213 6:131182280-131182302 GGATTTGTTTTTCATGGGTATGG - Intronic
1015286554 6:131491831-131491853 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1015526807 6:134181860-134181882 TGTTTTGTTTTGTTTTGATATGG + Intronic
1015733632 6:136374227-136374249 GGATTTGTATTGTGAAGGAAGGG + Intronic
1016758140 6:147709487-147709509 GGTTTTGTTTTGCTTTGGTTTGG + Intronic
1016865355 6:148760700-148760722 TGTTTTGTTTTGTTTTGCTATGG - Intronic
1017016423 6:150104631-150104653 TGTTTTGTTTTGTTTTGGTTTGG + Intergenic
1017126724 6:151071650-151071672 GGACTTGTTTTGTTTGGAAAAGG + Intronic
1017474762 6:154779009-154779031 GGTTTTGTTTTGTTTTGTTTTGG + Intronic
1017687290 6:156926295-156926317 GGTTTTGTTTTGTTTTGTTTAGG + Intronic
1017745355 6:157442389-157442411 GAAGTTGTTTTGTTTTGGTTTGG - Intronic
1017838121 6:158198914-158198936 GGGTTTGTTTTGTTTTGCTTTGG + Exonic
1017839592 6:158210414-158210436 GGTTTTGTTTTGTTTTGATATGG + Intergenic
1018175026 6:161171122-161171144 GGCTTTCTGTTGTTTAGTTAAGG + Intronic
1018783254 6:167088229-167088251 GGTTTTTTTTTTTTTTGGTATGG - Intergenic
1019091556 6:169539508-169539530 TGTTTTGTTTTTTTTAAGTAAGG - Intronic
1019749016 7:2717216-2717238 TGATTTGTTTTGTTTATAAAAGG + Intronic
1020146283 7:5646367-5646389 TGTTTTGTTTTGTTTTGGGATGG - Intronic
1020408348 7:7863570-7863592 TGTTTTGTTTTGTTTTGGTGTGG + Intronic
1020549032 7:9574813-9574835 GGTTTTGTTTTTATTAGGTGAGG + Intergenic
1021123213 7:16820581-16820603 GGCTTTGTTTTGTTTTGGTACGG + Intronic
1021254843 7:18378752-18378774 TGTTTTGTTTTGTTTTGGTATGG - Intronic
1021558803 7:21947998-21948020 TGTTTTGTTTTGTTTTGGTCAGG + Intergenic
1021583736 7:22185572-22185594 GTTTTTGTTTTGTTTTGGTTTGG - Intronic
1022353664 7:29589461-29589483 GTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1022380948 7:29859498-29859520 TGTTTTGTTTTGTTTGGGTGTGG + Intronic
1022666731 7:32417982-32418004 GTTTTTGTTTTGTTTTGGTTTGG + Intergenic
1024050195 7:45615593-45615615 TGTTTTGTTTTGTTGAGATAGGG - Intronic
1025884901 7:65579918-65579940 GGTTTTTTTTTTTTTTGGTATGG + Intergenic
1026114952 7:67488286-67488308 TGATTTGTTTTGTTTTGAGACGG - Intergenic
1026230162 7:68475909-68475931 GTATTTTTTTTGTAGAGGTAAGG + Intergenic
1026346651 7:69480413-69480435 TGTTTTGTTTTGTTTTGATATGG + Intergenic
1026551968 7:71376313-71376335 GGATTTTTTTTTTTTAGCTCTGG + Intronic
1027581888 7:80007015-80007037 TGTTTTGTTTTGTTTAGGTCTGG + Intergenic
1027973047 7:85111429-85111451 GGTTTTGTTTTGTTTTGTTGTGG - Intronic
1028295149 7:89120312-89120334 TGCTTTGTTTTGTTTTGGTTTGG - Intronic
1028526119 7:91788829-91788851 TGTTTTGTTTTGTTTGGATATGG + Intronic
1028626557 7:92883762-92883784 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1028702959 7:93804364-93804386 AGTTTTGTTTTGTTTTGGTTTGG - Intronic
1028894568 7:96026827-96026849 AGATTTGTTTTAGTTAGGGAGGG - Intronic
1029603153 7:101581809-101581831 GGATTTGTTTTAATCAGGTATGG + Intergenic
1030034991 7:105401391-105401413 TGTTTTGTTTTGTTTTGGTTTGG + Intergenic
1030201804 7:106913528-106913550 GGATTTGGTTTGGTTTGGTTTGG + Intergenic
1030916063 7:115315218-115315240 TTGTTTGTTTTGTTTTGGTATGG - Intergenic
1031333837 7:120501065-120501087 GGGTTTTGTTTGTTTAAGTAAGG + Intronic
1031339130 7:120577588-120577610 GGTTTTGTTTTGTTTAGAGATGG + Intronic
1032871829 7:135994075-135994097 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
1033044640 7:137950556-137950578 GGATTTGGTTTGTTTGGGGTGGG + Intronic
1033277087 7:139980153-139980175 GGATTTGTTTTGCTAAATTATGG - Intronic
1033346370 7:140528188-140528210 GTTTTTGTTTTGTTTGTGTAGGG - Intronic
1033672623 7:143507468-143507490 AGATTTGTTTTAATCAGGTAGGG - Intergenic
1034906722 7:154955029-154955051 GATTTTGTTTTGTTTTGGTGAGG - Intronic
1035547382 8:493779-493801 GTTTTTGTTTTGTTTTGGTTTGG + Intronic
1035836824 8:2763873-2763895 GGTTTTGTTTTAATTGGGTATGG + Intergenic
1035955878 8:4079015-4079037 TGATTTGTTGTGTCCAGGTATGG + Intronic
1037432054 8:18824005-18824027 AAATTTGTTTTATTTAGGCAAGG - Intronic
1037931512 8:22883101-22883123 GGATTTGTTTTAATCAGGTGTGG - Intronic
1038058138 8:23881527-23881549 GGCTGTGTTTTGTTTCGGTTTGG - Intergenic
1038113719 8:24529234-24529256 TGTTTTGTTTTGTTTTGGCAAGG + Intergenic
1038742487 8:30227573-30227595 GGTTTGGTTTTGTTTAGAGATGG - Intergenic
1038803372 8:30769220-30769242 ATATTTTTTTTGTTTAGGCATGG + Intergenic
1038847691 8:31244742-31244764 GTTTTTGTTTTGTTTTGGTTTGG - Intergenic
1039059562 8:33562917-33562939 TGTTTTGTTTTGTTTAGAGACGG - Intronic
1039365123 8:36921130-36921152 GGTTTTGTTTTGTTTTGTTTTGG - Intronic
1039851907 8:41375481-41375503 TGATTTTTTTTTTTTTGGTAGGG - Intergenic
1040031528 8:42829232-42829254 AGAATTGTTTTGTTTTGTTAAGG + Intergenic
1040059949 8:43095353-43095375 TTATTTGTTTTGTTTTGGTTTGG + Intronic
1040655556 8:49503498-49503520 TGATTTGTAATGTTTAGGGAGGG + Intergenic
1041061716 8:54041198-54041220 GAATTTGTTTTCTTTAGAGATGG - Intergenic
1041360147 8:57044573-57044595 GGATTTGTTTTGTTTTTATATGG - Intergenic
1041529594 8:58850192-58850214 GGATTTGTTTCAGTCAGGTATGG + Intronic
1041930372 8:63280233-63280255 GTATTTGTTTTAATCAGGTATGG + Intergenic
1042309668 8:67367591-67367613 GGATTTTTTTTTTTTTGGTGGGG + Intergenic
1042932649 8:74029114-74029136 GGATTTGTTTTAATCAGATATGG + Intergenic
1043386754 8:79756675-79756697 TGTTTTGTTTTGTTTTGGTGGGG + Intergenic
1043641012 8:82450769-82450791 GAATTTCTTTTGTTTAAGAATGG + Intergenic
1044531634 8:93314272-93314294 TGTTTTGTTTTGTTTTTGTAAGG - Intergenic
1045289961 8:100824638-100824660 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
1046177870 8:110602768-110602790 GAGGTTGTTTTGTTTAGCTAAGG + Intergenic
1046465801 8:114601719-114601741 GGATTTGGGTTGTTTTGGTTTGG - Intergenic
1046568457 8:115931510-115931532 GGGTTTATGTTGTTTAGGGATGG + Intergenic
1046892962 8:119442910-119442932 GGTTTTGTTTTGTTTTGGTTTGG + Intergenic
1046978889 8:120314865-120314887 AGATTTGTTTTGTTTTGTTTTGG - Intronic
1047190658 8:122676236-122676258 TGGTATGTTTTGTTTAGTTAAGG + Intergenic
1048027982 8:130604297-130604319 GGTTGTGTTTTGTTTCGGTTTGG - Intergenic
1048239410 8:132726258-132726280 GGGTTTTTTTTGTTTTGGTTTGG - Intronic
1050090221 9:2011000-2011022 GGTTTTGTTTTGTTTTGTTTTGG - Intergenic
1050095009 9:2055493-2055515 GGGTTTGTTTTGTTAAAGTCTGG + Intronic
1051059757 9:13032339-13032361 GGTTGTGTTTTGATTTGGTAGGG + Intergenic
1051625634 9:19097744-19097766 GGCTTTGTTTTGATTAATTAGGG - Intronic
1051760117 9:20453554-20453576 GGTTTTGTTTTGTTTTGGTGGGG - Intronic
1052859499 9:33428283-33428305 GGTTGTGTTTTGTTTTGGTTTGG - Intergenic
1052938161 9:34110775-34110797 TGTTTTGTTTTGTTGAGGCAGGG - Intronic
1053192338 9:36082887-36082909 GGTTTTGTTTTATTTTGGTTTGG + Intronic
1053658142 9:40241465-40241487 GTTTTTGTTTTGTTTTGGTTTGG - Intronic
1053832015 9:42093350-42093372 TAATTTGTTTTGTTTTGGTTTGG - Intronic
1054526456 9:66134756-66134778 GTTTTTGTTTTGTTTTGGTTTGG + Intronic
1054856097 9:69901120-69901142 GGTTTTGTTTTGTTTGGTTTTGG + Intronic
1055263061 9:74461586-74461608 GGATGTGCTTTGTTTTGTTAAGG + Intergenic
1055522359 9:77094378-77094400 TGTTTTGTTTTTTTGAGGTAGGG - Intergenic
1055615693 9:78070002-78070024 TGTTTTGTTTTGTTTTGGGACGG + Intergenic
1055839412 9:80484223-80484245 GGATTTGTTTTAATTAAGTATGG - Intergenic
1056072982 9:83008011-83008033 GGATCTCTGTGGTTTAGGTAAGG - Intronic
1057547789 9:96031044-96031066 GGACTTGTTTTAATCAGGTATGG - Intergenic
1057561847 9:96134069-96134091 GGAATTATTTTGTTTATGTATGG - Intergenic
1058154265 9:101495843-101495865 GTTTTTGTTTTGTTTTGGTTTGG - Intronic
1058350118 9:104011118-104011140 TGTTTTGTTTTGTTTTGTTAGGG - Intergenic
1058359042 9:104120675-104120697 GTATTTCTTCTGTGTAGGTATGG + Intronic
1058437733 9:104978597-104978619 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
1059541160 9:115131914-115131936 GGATTAGTCTTGTTTAAGTAAGG + Intergenic
1059915908 9:119099947-119099969 TTATTTGTTTTGTTTTGGTTTGG + Intergenic
1060468094 9:123925485-123925507 TGTTTTGTTTTGTTTTGGTGGGG + Intronic
1060633286 9:125179396-125179418 TGTTTTGATTTGTTTAGGTTTGG + Intronic
1060664011 9:125422209-125422231 GGATGTGTTTTAATCAGGTATGG + Intergenic
1061084701 9:128392212-128392234 GGATTTGTTTTGTTTAGGTAGGG + Intergenic
1203652717 Un_KI270751v1:142946-142968 GGTTTTGTTTTGTTTTGAGATGG - Intergenic
1203659811 Un_KI270753v1:31395-31417 GGATTTGTTTAATTCAGGTATGG + Intergenic
1186012226 X:5147310-5147332 AAGTTTGTTTTGTTTAAGTAGGG - Intergenic
1186095106 X:6092116-6092138 GTAATTGTTTTGTTCAGGGAAGG - Intronic
1186124204 X:6395261-6395283 AGTTTTGTTTTGTTTTGGTTTGG - Intergenic
1186155171 X:6717723-6717745 GGATTTGACTTGATTAGGTGAGG + Intergenic
1187378907 X:18782672-18782694 GGATTTGTTTTACTTAGGTGTGG + Intronic
1188677563 X:32961137-32961159 GTTTTTGTTTCGTTTTGGTATGG + Intronic
1188920145 X:35964416-35964438 GACTTTGTTGTGTTTAGGTGTGG + Intronic
1189821935 X:44877534-44877556 GGTTTTTTTTTTTTTAAGTAGGG + Intronic
1189921736 X:45909208-45909230 GGATTTGTTTAAATCAGGTATGG + Intergenic
1189963392 X:46347170-46347192 GGATTTTTTTTGTTTATGAGAGG - Intergenic
1190025953 X:46923336-46923358 GGGTTTGTTTTGTTTTGCTGTGG + Intronic
1190471465 X:50784137-50784159 TGTTTTGTTTTGTTTAGAGATGG + Intronic
1190850421 X:54234849-54234871 GCTTTTGTTTTGTTTTGGTTTGG - Intronic
1191481133 X:61342005-61342027 AGAGTGTTTTTGTTTAGGTATGG - Intergenic
1191637617 X:63394343-63394365 GGTTTTGTTTTGTTTTGGGGGGG + Intergenic
1191838610 X:65492128-65492150 TGTTTTGTTTTGTTTTGGTTTGG + Intronic
1191909237 X:66130103-66130125 GGGTTTGTTTTGTTTTGAGAAGG - Intergenic
1192411251 X:70934572-70934594 AGATTTTTTTTTTTTAGGTAGGG + Intergenic
1193480898 X:82027411-82027433 GTCTTTGTTTTGTTTAGCTTTGG - Intergenic
1193635584 X:83945694-83945716 GGTTTTGTTTTGTTTTGAGATGG + Intergenic
1194292269 X:92088926-92088948 GGTTTTGTTTTGTTTTGTTTTGG - Intronic
1194697587 X:97074035-97074057 GATTTTGTTTTCTTTTGGTATGG + Intronic
1195918413 X:109958285-109958307 TGTTTTGTTTTGTTTTGGTTTGG + Intergenic
1195918416 X:109958327-109958349 TGTTTTGTTTTGTTTTGGTTTGG + Intergenic
1196143759 X:112294609-112294631 TGTTTTGTTTTGTTTTGGTTTGG - Intergenic
1196751703 X:119123918-119123940 TGTTTTGTTTTGTTTTGGTGGGG + Intronic
1197147994 X:123190084-123190106 GGTTTTGTTTTGTCTTGGTTTGG + Intronic
1197378955 X:125714821-125714843 GGTTTTGTTTTGTTTAGGTTAGG - Intergenic
1198440917 X:136662471-136662493 GGTTTTGTTTTGTTTTAGTGGGG - Intergenic
1200609773 Y:5313552-5313574 GGTTTTGTTTTGTTTTGTTTTGG - Intronic
1200703908 Y:6425321-6425343 TGTTTTGTTTTGTTTTGGTGTGG + Intergenic
1201030203 Y:9739387-9739409 TGTTTTGTTTTGTTTTGGTGTGG - Intergenic
1201391294 Y:13500179-13500201 TGTTTTGTTTTGTTTTGTTATGG - Intergenic
1201624116 Y:15995070-15995092 TGTTTTATTTTGTTTTGGTAGGG - Intergenic
1201687315 Y:16720870-16720892 GTATTTTTTTTTTTTAGGTTTGG - Intergenic
1202097964 Y:21273266-21273288 GGTTTTGTTTTGTTTTGGTTTGG + Intergenic