ID: 1061084874

View in Genome Browser
Species Human (GRCh38)
Location 9:128392988-128393010
Sequence GAGGGGAGTCGGGGTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 200}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061084874_1061084891 12 Left 1061084874 9:128392988-128393010 CCTGGGGAACCCCGACTCCCCTC 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1061084891 9:128393023-128393045 GCCTGGGATCTCCGGGAATCCGG 0: 1
1: 0
2: 0
3: 5
4: 110
1061084874_1061084886 5 Left 1061084874 9:128392988-128393010 CCTGGGGAACCCCGACTCCCCTC 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1061084886 9:128393016-128393038 GCCCCCAGCCTGGGATCTCCGGG 0: 1
1: 0
2: 4
3: 46
4: 366
1061084874_1061084882 -4 Left 1061084874 9:128392988-128393010 CCTGGGGAACCCCGACTCCCCTC 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1061084882 9:128393007-128393029 CCTCTCCCTGCCCCCAGCCTGGG 0: 1
1: 0
2: 16
3: 157
4: 1189
1061084874_1061084880 -5 Left 1061084874 9:128392988-128393010 CCTGGGGAACCCCGACTCCCCTC 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1061084880 9:128393006-128393028 CCCTCTCCCTGCCCCCAGCCTGG 0: 1
1: 3
2: 15
3: 182
4: 1208
1061084874_1061084885 4 Left 1061084874 9:128392988-128393010 CCTGGGGAACCCCGACTCCCCTC 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1061084885 9:128393015-128393037 TGCCCCCAGCCTGGGATCTCCGG 0: 1
1: 0
2: 3
3: 34
4: 321
1061084874_1061084893 16 Left 1061084874 9:128392988-128393010 CCTGGGGAACCCCGACTCCCCTC 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1061084893 9:128393027-128393049 GGGATCTCCGGGAATCCGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 58
1061084874_1061084896 29 Left 1061084874 9:128392988-128393010 CCTGGGGAACCCCGACTCCCCTC 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1061084896 9:128393040-128393062 ATCCGGAAGGCAGGAGCCCCAGG 0: 1
1: 0
2: 0
3: 19
4: 227
1061084874_1061084894 20 Left 1061084874 9:128392988-128393010 CCTGGGGAACCCCGACTCCCCTC 0: 1
1: 0
2: 1
3: 15
4: 200
Right 1061084894 9:128393031-128393053 TCTCCGGGAATCCGGAAGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061084874 Original CRISPR GAGGGGAGTCGGGGTTCCCC AGG (reversed) Intergenic
900391443 1:2435681-2435703 GAGGGGAGACTGGGTTTCCAGGG + Intronic
901063822 1:6485631-6485653 GCGGGGAGGCGGGGATCCCCGGG - Intronic
901175377 1:7294908-7294930 GAGGGGAGTCGGGAGTCACGGGG - Intronic
901233227 1:7652669-7652691 GAGGGAAGTCTGGTTTCCCTCGG - Intronic
901660126 1:10794054-10794076 GAGGGGGGTAGTTGTTCCCCGGG - Intronic
902275671 1:15337559-15337581 GGGGTGAGTAGGGGTGCCCCTGG + Intronic
902937371 1:19773907-19773929 TGGGGGAGTCCTGGTTCCCCTGG + Intronic
903038141 1:20508069-20508091 GTGGAGAGTCGGGGGTCACCAGG - Exonic
904463377 1:30693504-30693526 GAGGGGAGTCTGAGTTCCTGAGG - Intergenic
905794906 1:40810268-40810290 GACAGGGGTCGGGGTGCCCCAGG - Intronic
905874404 1:41422933-41422955 GAGGGGATTGTGGGTTCCCAGGG + Intergenic
906711074 1:47930338-47930360 GAGGGGTGTTGGGGTTTCTCTGG + Intronic
907385886 1:54125116-54125138 GAGGGGACTCTGAGTTCACCAGG - Intergenic
908913860 1:69103549-69103571 GAGGGGAGTCATGGTTCCTGGGG + Intergenic
911040724 1:93588925-93588947 GAGGGGCGCCGGGGTGCCCAAGG - Intronic
919757095 1:201073094-201073116 GAAGGGAGTTGAGCTTCCCCAGG + Intronic
920307799 1:205030239-205030261 GAGGGGACTAGGGGGTCTCCTGG - Intergenic
920678349 1:208054333-208054355 GAGGGGAGTGGGGGCTTCCTGGG + Intronic
1063067490 10:2624075-2624097 GAGGGCAATCGTGTTTCCCCAGG + Intergenic
1063960445 10:11301565-11301587 GAGGGGAGGTGGGCTTCTCCAGG + Intronic
1064552982 10:16521204-16521226 CAGGGGAGTTGGGGTTCGCAGGG - Exonic
1067766791 10:49092977-49092999 GAAGGGAGACGGTTTTCCCCTGG - Intronic
1067897201 10:50196342-50196364 GAGGGGAGTCTGGATTCCTTAGG - Intronic
1067951771 10:50745682-50745704 GAGGGGAGTCTGGATTCCTTAGG + Intronic
1069640733 10:69953973-69953995 AAGGGGAGCCGGGGTTACCAGGG + Intronic
1069900105 10:71702147-71702169 CATGGGGGTCGGGGTTCTCCCGG - Intronic
1070314039 10:75294376-75294398 GAGGGCGGACGGGGTTCCCCTGG + Intergenic
1071563831 10:86661590-86661612 GAGGGAGGTCAGGGTTCCCTGGG + Intronic
1072361658 10:94664768-94664790 GCTGGGAGTGGGGGTTCCCCTGG + Intergenic
1075741319 10:124698176-124698198 GCTGGGGGCCGGGGTTCCCCAGG - Intronic
1077186936 11:1239622-1239644 GTGGGGGGGCGGGGATCCCCAGG + Intronic
1077217776 11:1402202-1402224 GGTGGGTGTCGGGGCTCCCCGGG + Intronic
1077515768 11:3001289-3001311 AAGGGGAGTTGGGGTTACCCAGG - Intronic
1078337779 11:10477378-10477400 GTGGGGAGGCCGGGTTCCACTGG + Intronic
1078667855 11:13341056-13341078 GAGGGGATTCTGGGTGCCCGAGG - Intronic
1083314256 11:61804612-61804634 GTGGGGGATAGGGGTTCCCCAGG - Intronic
1084534824 11:69750504-69750526 CAGGGGCGTCTGGGGTCCCCAGG - Intergenic
1085199444 11:74692849-74692871 GAGGGGAGTGGGGGGCTCCCAGG - Intergenic
1085307460 11:75496094-75496116 CAGGGGAGCCAGGGTGCCCCGGG + Intronic
1085389000 11:76172644-76172666 CAGGGGAGTCGTGCTTTCCCTGG - Intergenic
1085784519 11:79438667-79438689 GAGGGGCTTTGGGGCTCCCCAGG + Intronic
1092255630 12:6925504-6925526 GAAGGGAGTCGGGGTGCACAGGG + Intronic
1092945644 12:13451428-13451450 GAGTGGGGGCGGGGTTCACCAGG - Intergenic
1094393011 12:29973601-29973623 GAGGGGATTGGGGGTGCCACAGG - Intergenic
1101663184 12:106785329-106785351 GAGGTGAGTAGGGATTCACCAGG - Intronic
1101943310 12:109116817-109116839 GACGGGAGTCGTTTTTCCCCGGG - Intronic
1103527910 12:121579742-121579764 GAGCGGGCTCGGGGTTCGCCCGG - Intronic
1104843310 12:131834726-131834748 AAGGGGAGTAGGGGTTAACCAGG - Intronic
1104882719 12:132083884-132083906 CAGGGGAGTCGGGGTGCCTAGGG - Intergenic
1112051048 13:95644190-95644212 GAAGGGCGCCGAGGTTCCCCTGG - Intronic
1113897916 13:113777495-113777517 GAGGGGAGGCGCGGTGGCCCCGG + Intronic
1115399386 14:32939723-32939745 GTGGGGGGCCGGGGATCCCCGGG + Intronic
1118699213 14:68416754-68416776 GATGGGAGTCAGGCTTCCCCTGG + Intronic
1119385915 14:74258119-74258141 GAGAAGAGTTGGGGGTCCCCGGG + Intronic
1122371155 14:101229787-101229809 GAAGGGAGACGGTTTTCCCCTGG + Intergenic
1122651853 14:103230723-103230745 CAGGGGAGTCTGTGTCCCCCAGG + Intergenic
1122888901 14:104723749-104723771 CAGGGCACTCGGGGTTCCACGGG + Intergenic
1123632721 15:22273024-22273046 GGGGTGTGTCGGTGTTCCCCAGG + Intergenic
1127124659 15:55800417-55800439 CTGTGGAGTGGGGGTTCCCCAGG + Intergenic
1128380330 15:67107554-67107576 GATGGGAGAGGGGCTTCCCCCGG + Intronic
1130967513 15:88708304-88708326 GAGAGGAGTCTGCATTCCCCTGG + Intergenic
1132435072 15:101793562-101793584 GATGGGGGTCTGGGTTGCCCAGG - Intergenic
1132674956 16:1117678-1117700 GTGGGGAGTGGGGGTCCGCCCGG - Intergenic
1132915628 16:2341779-2341801 GAGGTGGGTCGGGGTGTCCCTGG + Intergenic
1133031936 16:3015332-3015354 GAGGGGAATGGGGGCTCCGCTGG - Exonic
1133209267 16:4254014-4254036 AAGGGGAGGTGGGATTCCCCTGG + Intergenic
1135665774 16:24334565-24334587 GAGTGGAGACAGGTTTCCCCAGG - Intronic
1136286196 16:29244185-29244207 GAGGGGAGTCAGGGTGACTCTGG + Intergenic
1138394367 16:56692646-56692668 GAGGGGAGTCAGGGGTGCCAAGG - Intronic
1138926878 16:61603196-61603218 TTGGGGAGTGGGGGTTCCACAGG + Intergenic
1141681590 16:85547384-85547406 GAGGGATGTCTGGATTCCCCGGG - Intergenic
1141970377 16:87477868-87477890 GGGGCGTGTCGGTGTTCCCCAGG - Intronic
1142091538 16:88214377-88214399 GAGGGGAGTCAGGGTGACTCTGG + Intergenic
1142141193 16:88473560-88473582 GAAGGGAGCAGGGGTCCCCCAGG - Intronic
1142371675 16:89686301-89686323 GTGGGGGGGGGGGGTTCCCCAGG - Intronic
1142438225 16:90076720-90076742 AAGGGGATTTGGGGTTCCTCGGG + Intronic
1142977742 17:3655826-3655848 GAGGGGAGTCAGGAGGCCCCCGG - Intronic
1143119250 17:4596974-4596996 GAGGGGAGCCGGGGCTCACCTGG - Exonic
1143731595 17:8885473-8885495 CTGGGGAGGCGGGGTTACCCAGG - Intronic
1143731664 17:8885637-8885659 CTGGGGAGGCGGGGTTACCCAGG - Intronic
1143731746 17:8885818-8885840 CTGGGGAGGCGGGGTTACCCAGG - Intronic
1146517885 17:33503454-33503476 CCTGGGAGTCAGGGTTCCCCAGG + Intronic
1148211739 17:45812991-45813013 GAGGAGAGTGGGGGGTCCCTGGG - Intronic
1148391627 17:47276767-47276789 GAGAGGAGCAGGGCTTCCCCTGG + Intronic
1148701197 17:49588011-49588033 GAGGGGAGTCCAGGCTCCCTAGG - Intergenic
1148701313 17:49588654-49588676 GAGGGGAGTCCAGGCTCCCTAGG + Intergenic
1150108755 17:62479526-62479548 GAGGAGAGACGGGGGCCCCCAGG + Intronic
1150414345 17:64975306-64975328 GGGTGGAGTAGGGCTTCCCCGGG + Intergenic
1150797302 17:68248329-68248351 GAGTGGAGTGGGGGTTCCCCAGG - Exonic
1152001070 17:77645634-77645656 GGGGGCAGCCGGGGTCCCCCGGG + Intergenic
1152751882 17:82065968-82065990 GAGAGGGGTCGGGGCTCGCCGGG + Intergenic
1152779835 17:82222025-82222047 GAGCGGAGTTGGGGGTCCCAGGG - Intergenic
1152779849 17:82222072-82222094 GAGCGGAGTTGGGGGTCCCAGGG - Intergenic
1152779862 17:82222119-82222141 GAGCGGAGTTGGGGGTCCCAGGG - Intergenic
1152779875 17:82222166-82222188 GAGCGGAGTTGGGGGTCCCAGGG - Intergenic
1152779887 17:82222213-82222235 GAGCGGAGTTGGGGGTCCCAGGG - Intergenic
1152779900 17:82222260-82222282 GAGCGGAGTTGGGGGTCCCAGGG - Intergenic
1152876634 17:82790188-82790210 GAGGGTAGTCGGGGAGCCCAGGG - Intronic
1153475719 18:5496473-5496495 TAGGAGAGGCAGGGTTCCCCTGG + Intronic
1157595341 18:48860669-48860691 GATGGGAGTGGGGGCTCCCCAGG + Exonic
1158180760 18:54712912-54712934 GAAGGGAGACGGTTTTCCCCTGG + Intergenic
1159345773 18:67201218-67201240 GAGGGGAGATGGTTTTCCCCTGG + Intergenic
1160816117 19:1036573-1036595 GAGAGGAGTCGGGGGCACCCGGG - Intronic
1160861334 19:1238257-1238279 GAGGGGAGTCCGTGCCCCCCCGG - Intergenic
1160874885 19:1292305-1292327 GCCGGGGGTGGGGGTTCCCCTGG + Intronic
1160943288 19:1630024-1630046 GAGGGCAGGCGGGGGTCCCGGGG - Intronic
1161241383 19:3225441-3225463 GAGGGGTGCCGGCGTTCCCGAGG - Intronic
1161311271 19:3595517-3595539 GGGAGGAGTTGGGGGTCCCCGGG + Intronic
1161669776 19:5600060-5600082 GTGGGGAGTGGGGGTTCCGAGGG - Intronic
1163111009 19:15161015-15161037 GCGGGGAGACGGGGGTCCCTGGG + Exonic
1163744004 19:19033969-19033991 GTGGGGAGTGGGGGTGCCGCAGG + Exonic
1165160931 19:33815824-33815846 GTGGGGAGTGGTGGTTCCCGAGG - Intergenic
1166308948 19:41951734-41951756 GTGGGGACCCGGGGTGCCCCCGG - Intergenic
1166679962 19:44759904-44759926 GAGGGGAGTGGCTGTTCCCTGGG - Exonic
925117936 2:1396201-1396223 GAGGCCAGCAGGGGTTCCCCAGG + Intronic
925938143 2:8787903-8787925 GAGGGGAGCTGGGTTTCCCCAGG + Intronic
926113163 2:10195402-10195424 GCGGGGACTCGGTGCTCCCCAGG - Intronic
926304450 2:11627960-11627982 GAGGGGAGGTGGGGTTTCCAGGG + Intronic
927889826 2:26741416-26741438 GAAGGGAGTGGGGGTCCCCATGG - Intergenic
928205635 2:29281295-29281317 GAAAGGAGGCTGGGTTCCCCAGG + Intronic
931034747 2:58227451-58227473 GAAGGGAGACGGTTTTCCCCTGG + Intronic
932725776 2:74178687-74178709 GAGGGGAGGCGAGGGGCCCCTGG + Exonic
935882211 2:107575922-107575944 GAAGGGAGATGGGTTTCCCCTGG - Intergenic
938448992 2:131399815-131399837 GAGGGGAGTGCTAGTTCCCCTGG + Intergenic
944357670 2:198811196-198811218 GAGGGCAATATGGGTTCCCCAGG - Intergenic
948155520 2:235778153-235778175 GAGGGGAGTCAGAGTGGCCCAGG - Intronic
948236821 2:236397403-236397425 GAGGGGAGTTGTGGCTGCCCTGG - Intronic
948718480 2:239881383-239881405 GGAGGGAGGCCGGGTTCCCCAGG - Intergenic
948854454 2:240723658-240723680 GAGTGGAGATGGGCTTCCCCTGG + Intronic
1169167133 20:3433769-3433791 GAGGGGAGCAGGAGGTCCCCAGG + Intergenic
1173863728 20:46300697-46300719 GAGGGGACTGGGGGGTCCCTGGG - Intronic
1174953405 20:55067540-55067562 GCTGGGAGTGGGGGCTCCCCTGG + Intergenic
1175478754 20:59296452-59296474 AAGGGGAGGGGTGGTTCCCCAGG + Intergenic
1176009612 20:62885940-62885962 GGGGGCAGTCGAGGTTGCCCAGG + Intronic
1176030825 20:63010405-63010427 GAGGGGAGCCGGGGTTACTGGGG - Intergenic
1178286018 21:31326109-31326131 GAGGGGAGTTGGGGTCTCGCTGG - Intronic
1178847842 21:36188305-36188327 TCAGGGAGTCGGGGTTCCACAGG - Intronic
1180188316 21:46151188-46151210 TAGGGGTGTCGGGGCTCCCAAGG + Intronic
1181044002 22:20206078-20206100 GAGGGGAGATGGTTTTCCCCTGG + Intergenic
1183744927 22:39686546-39686568 GAGCGGAGTCTGGGTTAGCCAGG + Exonic
1183983787 22:41558050-41558072 GAGGGGAGAGGTGATTCCCCAGG + Intergenic
1185211909 22:49575286-49575308 GAGCGGAGTCTTGGTGCCCCTGG - Intronic
1185375888 22:50482403-50482425 GAGGGGACGCGGGCTTCCCCTGG + Intronic
950923493 3:16717531-16717553 CTGGGGAGGCGGGGTTCCCTTGG + Intergenic
953816762 3:46164118-46164140 GCTGGGAGTGGGGGTTCCCTTGG + Intronic
955927563 3:64023086-64023108 GAGGCAAGTCGAGGTCCCCCAGG + Intronic
956386591 3:68725630-68725652 GCTGGGGGTGGGGGTTCCCCTGG + Intergenic
956619377 3:71205622-71205644 GTGAGGAGTCGGGCCTCCCCAGG + Intronic
958254712 3:91312309-91312331 GAGTGGAGTCTGGGCTCCTCTGG + Intergenic
963153023 3:142066708-142066730 GAGATGAGTCTGGGGTCCCCTGG - Intronic
964739431 3:159950101-159950123 GAGGGGTGTGTGGGTTCCTCCGG - Intergenic
966849608 3:184156294-184156316 GAGGGGTGTCGGGGGTGCTCGGG + Intronic
967387774 3:188927949-188927971 GGGAGGAGTTGGGGTTCTCCAGG + Intergenic
968760187 4:2438847-2438869 GAGCGGAATCGGATTTCCCCAGG - Intronic
968835954 4:2964172-2964194 CAGGGGGGCCAGGGTTCCCCGGG - Intronic
968835968 4:2964210-2964232 CAGGGAAATCGGGGTTCTCCGGG - Intronic
969440077 4:7211798-7211820 GAGGAGAGGCGGGGGGCCCCTGG + Intronic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
976751434 4:88454557-88454579 GAAGGGAGTTGGTTTTCCCCTGG - Intergenic
981660303 4:147158428-147158450 GCGGGGAGTCGGGGCTCCCTGGG + Intergenic
985565151 5:611925-611947 TAGGTGAGTCGGGGGTCCCCGGG + Intergenic
986307383 5:6525677-6525699 GAGGGGACTTGGGGATCCCTGGG - Intergenic
987149960 5:15028555-15028577 GAGGGGATTCTGGGTTCTCATGG + Intergenic
987862880 5:23508202-23508224 AAGGGGATTTGGGGTTCCTCAGG - Intronic
989103437 5:37840086-37840108 GAGGGGAGGCGCGGGGCCCCGGG + Intergenic
989166367 5:38436983-38437005 CTGGGCAGTGGGGGTTCCCCTGG + Intronic
990555808 5:56934667-56934689 GAGGGGAGGAGTGGTTACCCTGG - Intronic
994301919 5:98157487-98157509 GAGGGGAGATGGTTTTCCCCTGG + Intergenic
999252421 5:150190573-150190595 GAGGGGAGTCCTGGTTCACTGGG + Intronic
1000711619 5:164586774-164586796 ATGGGAAGTGGGGGTTCCCCAGG + Intergenic
1001268935 5:170296445-170296467 GAGGGTAGACGAGGTTCCCTAGG - Intronic
1002046181 5:176543014-176543036 GCGGGGGCTCGGAGTTCCCCGGG + Intronic
1004012416 6:11702400-11702422 GAGGGGACTTGGTGTTCCACAGG - Intergenic
1006604977 6:35249628-35249650 AAGGGGAGTAGGGCTCCCCCAGG - Exonic
1007173281 6:39879317-39879339 TGGGGGAGTCGGGGGTCCCCCGG - Exonic
1007704673 6:43783488-43783510 GAGGGGAGTCTCAGTTCCCCAGG + Intronic
1007723427 6:43899775-43899797 GAGGGGAGCAGGGGGTCTCCAGG + Intergenic
1009189108 6:60608195-60608217 GAGTGGAGTCTGGGCTCCTCTGG - Intergenic
1011795713 6:90948921-90948943 GAGGGAAGTAAGTGTTCCCCTGG - Intergenic
1013103978 6:107010843-107010865 AAGGGGAGTAGGGGTTGGCCGGG + Intergenic
1019220760 6:170470742-170470764 GAGGGGAGAGGGGTCTCCCCAGG + Intergenic
1019474764 7:1238751-1238773 GAGGGGACGCGGGGTTCCCATGG + Intergenic
1019600998 7:1883737-1883759 GAGGGCAGTCTGTGTGCCCCAGG + Intronic
1024342672 7:48283117-48283139 GAGAGGAGTCTGGTTTACCCAGG + Intronic
1026592735 7:71710988-71711010 GAGGGGAATCCTGCTTCCCCAGG + Intronic
1027047189 7:74998816-74998838 GAGGGGAGCCTGGGTTCCTGGGG + Intronic
1027130264 7:75585626-75585648 GCGGGGAGTCGGGCTGCCCTTGG - Intronic
1029495180 7:100892686-100892708 GGTGCGGGTCGGGGTTCCCCAGG - Exonic
1029524224 7:101085421-101085443 GAGGCGAGTCGGTGTGTCCCTGG + Exonic
1030234306 7:107242296-107242318 CTGGGCAGTGGGGGTTCCCCTGG - Intronic
1033037047 7:137884837-137884859 GAGGCAAGTGGGGGTTCCCCTGG - Intronic
1033418504 7:141185387-141185409 GAAGGGAGATGGTGTTCCCCTGG + Intronic
1035633537 8:1126869-1126891 GAGGGCAGTCCCGTTTCCCCAGG - Intergenic
1037373489 8:18205053-18205075 GAGGGGGGTCGAGGTACTCCCGG + Intronic
1038734527 8:30156725-30156747 GAAGGGAGCCGGCCTTCCCCAGG - Intronic
1038760848 8:30383892-30383914 GAGAGGAGTCGGGGGGCCGCGGG + Intergenic
1044857861 8:96494416-96494438 TTGGGGACTGGGGGTTCCCCAGG - Intronic
1045510839 8:102810799-102810821 GAGGGGAGGGCGGGTTGCCCGGG + Intergenic
1048292763 8:133192976-133192998 GTGGGTGGTCTGGGTTCCCCAGG - Intronic
1048407374 8:134137332-134137354 CAGTGGAGTAGGAGTTCCCCAGG + Intergenic
1049274167 8:141711438-141711460 ACAGGGAGCCGGGGTTCCCCAGG - Intergenic
1049410517 8:142471909-142471931 CAGAGGAGTCTGGGTGCCCCAGG + Intronic
1051913768 9:22184559-22184581 GCTGGGAGTGGGGGTTCCCTTGG - Intergenic
1052648834 9:31273449-31273471 CATGGGAGTGGGGGATCCCCTGG + Intergenic
1052732145 9:32300474-32300496 GAGGGGATTTGTGGTTTCCCTGG + Intergenic
1057444015 9:95101194-95101216 AAGGGGAGTCAGGGTCCCTCAGG - Exonic
1060218355 9:121751808-121751830 GAGGGGAATGGGAGTTCCACTGG - Intronic
1060775524 9:126371149-126371171 GAGAGGAGCCGGCCTTCCCCTGG + Intronic
1061084874 9:128392988-128393010 GAGGGGAGTCGGGGTTCCCCAGG - Intergenic
1062272846 9:135717724-135717746 GGGGTAAGTGGGGGTTCCCCGGG - Intronic
1062718473 9:138022872-138022894 GAGGGGTGTGGGGGCTCCCGCGG + Intronic
1189236696 X:39492507-39492529 GAGAGGAGTCTGAGTGCCCCTGG + Intergenic
1195803356 X:108736216-108736238 GAGTGCGGTCGGGGTTCCCGAGG + Exonic
1196925483 X:120629867-120629889 GAGGGGAGTCAGGGTGCGCTTGG + Intronic
1200142779 X:153910129-153910151 GAGGGGACTGGGGGGTCCACTGG - Intronic
1202333579 Y:23781050-23781072 GAGGAGAGTAGTGGTTCTCCCGG - Intergenic
1202537190 Y:25889013-25889035 GAGGAGAGTAGTGGTTCTCCCGG + Intergenic