ID: 1061084921

View in Genome Browser
Species Human (GRCh38)
Location 9:128393118-128393140
Sequence TGCGTGCGCGGGGCTGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 674
Summary {0: 1, 1: 0, 2: 5, 3: 58, 4: 610}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061084921_1061084933 7 Left 1061084921 9:128393118-128393140 CCCCGCCCAGCCCCGCGCACGCA 0: 1
1: 0
2: 5
3: 58
4: 610
Right 1061084933 9:128393148-128393170 GGGCGCTCTCCGCTTTCCTGTGG 0: 1
1: 0
2: 0
3: 3
4: 86
1061084921_1061084938 23 Left 1061084921 9:128393118-128393140 CCCCGCCCAGCCCCGCGCACGCA 0: 1
1: 0
2: 5
3: 58
4: 610
Right 1061084938 9:128393164-128393186 CCTGTGGCTGAGTCGCGGCCGGG 0: 1
1: 0
2: 1
3: 15
4: 136
1061084921_1061084935 18 Left 1061084921 9:128393118-128393140 CCCCGCCCAGCCCCGCGCACGCA 0: 1
1: 0
2: 5
3: 58
4: 610
Right 1061084935 9:128393159-128393181 GCTTTCCTGTGGCTGAGTCGCGG 0: 1
1: 0
2: 3
3: 16
4: 167
1061084921_1061084936 22 Left 1061084921 9:128393118-128393140 CCCCGCCCAGCCCCGCGCACGCA 0: 1
1: 0
2: 5
3: 58
4: 610
Right 1061084936 9:128393163-128393185 TCCTGTGGCTGAGTCGCGGCCGG 0: 1
1: 0
2: 2
3: 10
4: 81
1061084921_1061084939 24 Left 1061084921 9:128393118-128393140 CCCCGCCCAGCCCCGCGCACGCA 0: 1
1: 0
2: 5
3: 58
4: 610
Right 1061084939 9:128393165-128393187 CTGTGGCTGAGTCGCGGCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061084921 Original CRISPR TGCGTGCGCGGGGCTGGGCG GGG (reversed) Intergenic