ID: 1061088309

View in Genome Browser
Species Human (GRCh38)
Location 9:128412044-128412066
Sequence CAACTCAGGAGACGTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061088302_1061088309 9 Left 1061088302 9:128412012-128412034 CCACAAAGCAGGACAGGGGACCA 0: 1
1: 1
2: 3
3: 16
4: 168
Right 1061088309 9:128412044-128412066 CAACTCAGGAGACGTGAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 202
1061088297_1061088309 16 Left 1061088297 9:128412005-128412027 CCCTTGGCCACAAAGCAGGACAG 0: 1
1: 0
2: 0
3: 23
4: 274
Right 1061088309 9:128412044-128412066 CAACTCAGGAGACGTGAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 202
1061088298_1061088309 15 Left 1061088298 9:128412006-128412028 CCTTGGCCACAAAGCAGGACAGG 0: 1
1: 0
2: 3
3: 30
4: 387
Right 1061088309 9:128412044-128412066 CAACTCAGGAGACGTGAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 202
1061088295_1061088309 24 Left 1061088295 9:128411997-128412019 CCTGGGCTCCCTTGGCCACAAAG 0: 1
1: 0
2: 2
3: 17
4: 230
Right 1061088309 9:128412044-128412066 CAACTCAGGAGACGTGAAGCTGG 0: 1
1: 0
2: 0
3: 21
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061088309 Original CRISPR CAACTCAGGAGACGTGAAGC TGG Intronic
900000558 1:12642-12664 CAGCTCTGGAGACCTGATGCTGG - Intergenic
900020271 1:183161-183183 CAGCTCTGGAGACCTGATGCTGG - Intergenic
900588571 1:3446637-3446659 CTACTCAGGAGGCTTGAGGCAGG + Intergenic
902131628 1:14266644-14266666 CAACTCAGCAGGCGTGAGGTGGG + Intergenic
902140537 1:14350023-14350045 CTACTCGGGAGGCGTGAACCTGG + Intergenic
903818424 1:26082056-26082078 CAACTCTGGGGACTTGAACCTGG - Intergenic
904433849 1:30481495-30481517 CAACACAGGGGACTTGCAGCTGG - Intergenic
905553991 1:38867333-38867355 CTACTTGGGAGACGTGAGGCAGG + Intronic
907214729 1:52852473-52852495 CTACTCAGGAGCCTTGAGGCAGG - Intronic
907774045 1:57495507-57495529 CAACTCAGTAGAAGTGATGGTGG + Intronic
908301324 1:62763066-62763088 CTACTCGGGAGGCGTGAACCTGG + Intergenic
910125787 1:83840785-83840807 CAACTCCAGAGACCAGAAGCTGG + Intergenic
914991754 1:152504944-152504966 GCACACAGGTGACGTGAAGCAGG - Intergenic
915158667 1:153900306-153900328 CTACTCAGGAGGCTTGAGGCAGG + Intronic
916162286 1:161929675-161929697 CAACACAGGAGATGAGAACCAGG + Intronic
919267754 1:195294651-195294673 CTACTCAGGAGGCTTGAGGCAGG - Intergenic
920307381 1:205027639-205027661 CAATTCGGGGGACGTGAAGAAGG - Intergenic
921085668 1:211789757-211789779 CTACTCAGGAGAACTGAGGCAGG + Intronic
921933424 1:220774175-220774197 CTACTCAGGAGACTTGAGGCAGG - Intronic
923384170 1:233449924-233449946 CTACTCAGGAGACTTGAGGCAGG - Intergenic
923916806 1:238516270-238516292 CTACTCAGGAGTCATGTAGCTGG + Intergenic
924593044 1:245421678-245421700 CAACCCAGAAGATTTGAAGCAGG + Intronic
924811233 1:247404309-247404331 CTACTCAGGAGGCTTGAGGCAGG - Intergenic
1065541529 10:26773829-26773851 GACCACAGGAGACATGAAGCAGG - Intronic
1065593369 10:27288341-27288363 CTACTCAGGAGGCTTGACGCAGG - Intergenic
1065656998 10:27961953-27961975 CTACTCAGGAGGCTTGATGCAGG + Intronic
1066101996 10:32125875-32125897 CTACTCAGGAGGCCTGAGGCAGG + Intergenic
1067725811 10:48769968-48769990 CAACGCAGGAGACGGGATGGAGG - Intronic
1067794184 10:49308706-49308728 CAAAACTGGTGACGTGAAGCAGG + Intronic
1068510421 10:57958558-57958580 CAACTCAGGAGATCTGAATTAGG - Intergenic
1069538203 10:69271586-69271608 CTACTCAGGAGGCTTGAGGCAGG - Intronic
1071702784 10:87959001-87959023 CTACTCAGGAGGCTTGAGGCAGG + Intronic
1072338039 10:94417858-94417880 CTACTCGGGAGGCGTGAGGCAGG - Intronic
1074099077 10:110339465-110339487 CAACACAGGAGACCTAAGGCAGG + Intergenic
1074382934 10:112994987-112995009 CTACTCAGGAGGCTTGAGGCAGG + Intronic
1075684583 10:124354598-124354620 CCACTGAGGACAGGTGAAGCTGG + Intergenic
1075853629 10:125609059-125609081 CTACTCAGGAGGCTTGAACCTGG + Intronic
1077280870 11:1744901-1744923 CAGGTCAGGAGACCTGCAGCTGG + Intronic
1077591963 11:3499336-3499358 CAACTCAGGAGGCATCAAGGAGG - Intergenic
1078972778 11:16433662-16433684 AAACTCAGGAGACTTGAAGAAGG + Intronic
1079314033 11:19392418-19392440 CAGCTGAGGTGACTTGAAGCTGG + Intronic
1084280613 11:68088521-68088543 CATCTCAGGAGAGGTGGGGCAGG + Intronic
1084440654 11:69170943-69170965 CAACTCTGGAGGTGGGAAGCTGG - Intergenic
1084719418 11:70894721-70894743 CAACTCAGGATCTGTGGAGCTGG + Intronic
1084825018 11:71723421-71723443 CAACTCAGGAGGCATCAAGGAGG + Intergenic
1089238152 11:117050573-117050595 CTACTCAGGAGGCTTGAGGCAGG + Intronic
1091373643 12:12769-12791 CAGCTCTGGAGACCTGATGCTGG - Intergenic
1091805344 12:3352118-3352140 AAATTCAGCAGAGGTGAAGCGGG - Intergenic
1092418086 12:8307467-8307489 CAACTCAGGAGGCATCAAGGAGG - Intergenic
1092693027 12:11136090-11136112 TATCTCAGGAGATGTGAAGAAGG - Intronic
1093306430 12:17526712-17526734 CACCTCAGCAGATGTAAAGCAGG + Intergenic
1093460781 12:19405044-19405066 CTACTCAGGAGGCTTGAGGCAGG - Intronic
1093634307 12:21446311-21446333 CTACTCGGGAGACTTGAGGCAGG + Intronic
1093887122 12:24474959-24474981 CTACTCAGGAGGCTTGAGGCAGG - Intergenic
1093891374 12:24525759-24525781 CGACTCGGGAGGCGTGAACCCGG + Intergenic
1097806126 12:63966961-63966983 CAACTTATGAGACGTGAATATGG - Intronic
1100161307 12:91864260-91864282 CAGCTCAGGAGAGGTGAGGAGGG - Intergenic
1100331840 12:93590139-93590161 CTACTCAGGAGGCTTGAACCCGG + Intergenic
1101984276 12:109433484-109433506 CAACTCAAGGGACATGAATCGGG + Intronic
1102317697 12:111903091-111903113 CTACTCTGGAGGCTTGAAGCAGG + Intergenic
1102873528 12:116432323-116432345 GAACTCAGGAGAAGTGAGGCTGG + Intergenic
1103757481 12:123220451-123220473 CTACTCAGGAGACTTAAGGCAGG + Intronic
1105221202 13:18329449-18329471 CTACTCAGGAGGCTTGAGGCAGG + Intergenic
1106547055 13:30739803-30739825 AAGGTCAGGAGTCGTGAAGCTGG + Intronic
1106560909 13:30845521-30845543 CTACTCAGGAGGCTTGAGGCGGG + Intergenic
1108017453 13:46090833-46090855 CTACTCAGGAGGCTTGAGGCAGG - Intronic
1110091706 13:71457846-71457868 CACCTCAGGAGATATGAAGCAGG - Intronic
1113293326 13:108929619-108929641 CAACTCAGGAGAGGGGATTCTGG + Intronic
1117115805 14:52509867-52509889 CTACTCAGGAGGCCTGAGGCAGG + Intronic
1125862091 15:43008806-43008828 CAAGTCAGGAGACTTGAATTGGG - Intronic
1126584705 15:50272327-50272349 CTACTCAGGAGGCCTGAGGCAGG + Intergenic
1127086590 15:55429404-55429426 CTACTCAGGAGGCCTGAGGCAGG + Intronic
1127425696 15:58853707-58853729 CTACTCGGGAGACTTGAGGCAGG + Intronic
1127755199 15:62085359-62085381 CTACTCAGGAGACCTGAGGCAGG - Intergenic
1128018238 15:64367018-64367040 CGACTCAGGAGGCCTGAGGCAGG + Intronic
1128937473 15:71759333-71759355 AAACTCATGAGAAGTCAAGCTGG - Intronic
1129219266 15:74121988-74122010 TAACGCAGGAGACCTGAAGTGGG + Intronic
1130684718 15:86026731-86026753 CATCTCAGGTGACTTGCAGCTGG + Intergenic
1131126206 15:89859503-89859525 CTACACGGGAGACGTGAGGCAGG - Intronic
1131601233 15:93850905-93850927 CTACTCAGGAGGCTTGAACCTGG + Intergenic
1132066992 15:98739700-98739722 CTACTCGGGAGACTTGAACCTGG - Intronic
1132452949 15:101978303-101978325 CAGCTCTGGAGACCTGATGCTGG + Intergenic
1132453944 16:12323-12345 CAGCTCTGGAGACCTGATGCTGG - Intergenic
1134462065 16:14438077-14438099 CCACTCTGGAGAAGTGAAGATGG + Intronic
1134693822 16:16208482-16208504 CTACTCAGGAGGCTTGAGGCAGG - Intronic
1138657821 16:58500999-58501021 CAACGCTGGAGCCGTGAAGCTGG + Intronic
1139038224 16:62973743-62973765 CTACTCAGGAGGCCTGAGGCAGG - Intergenic
1142353893 16:89592400-89592422 CAACTACACAGACGTGAAGCAGG - Intronic
1148007467 17:44445615-44445637 CTACTCAGGAGGCTTGAGGCAGG - Intronic
1148194817 17:45705695-45705717 AAACTCAGGGGACTTGGAGCAGG + Intergenic
1148642057 17:49195103-49195125 CTACTCAGGAGGCTTGAGGCAGG - Intergenic
1151620136 17:75240268-75240290 CAGCCCAGGAGACATGACGCTGG + Intronic
1151920852 17:77154361-77154383 CTACTCAGGAGACTTGAGACAGG + Intronic
1152859644 17:82688502-82688524 CTACTCAGGAGGCTTGAGGCAGG + Intronic
1153254460 18:3156715-3156737 CTACTCAGGAGGCTTGAGGCAGG - Intronic
1154962259 18:21321181-21321203 CTACTCAGGAGGCCTGAGGCAGG + Intronic
1156469767 18:37369966-37369988 CAGCTCAGCAGAGGTGAAGAGGG - Intronic
1157788696 18:50510299-50510321 CTACTCAGGAAAACTGAAGCAGG - Intergenic
1158804061 18:60947876-60947898 CTACTCAGGAGGCTTGAGGCGGG + Intergenic
1162526051 19:11207303-11207325 CTACTCAGGAAGCTTGAAGCGGG - Intronic
1162636798 19:11975208-11975230 CTACTCAGGAGAACTGAGGCAGG - Intronic
1162716705 19:12638896-12638918 CAACTCAGCAAACGTGGAGAAGG + Intronic
1163959073 19:20670194-20670216 CTACTCGGGAGACTTGAGGCAGG + Intronic
1164069063 19:21749528-21749550 CAAGTCAGGATAGGTGATGCAGG - Intronic
1165479950 19:36056920-36056942 CTACTCAGGAGGCTTGAGGCAGG - Intronic
1166269371 19:41704530-41704552 CAACCCAGGAGCTGGGAAGCTGG + Intronic
1167225522 19:48236884-48236906 CTACTCAGGAGGCTTGAGGCAGG - Intronic
1168651057 19:58092462-58092484 CTACTCAGGAGGCCTGAGGCAGG + Intronic
925843755 2:8017515-8017537 CAGCTCAGGAGACTTGAGGCAGG - Intergenic
927805202 2:26140895-26140917 CTACTCAGGAGGCTTGAGGCAGG - Intergenic
928088239 2:28358941-28358963 CAGCACAGGAGACGTGGAGAAGG + Intergenic
928575419 2:32649654-32649676 CTACTCGGGAGACTTGAGGCAGG - Intronic
929467609 2:42159368-42159390 CTACTCAGGAGGCTTGAGGCAGG - Intergenic
931826628 2:66007158-66007180 CAACTGAAGGGACGGGAAGCAGG + Intergenic
934853615 2:97716101-97716123 CAACGGAGGAGGCCTGAAGCCGG + Intronic
935978274 2:108601043-108601065 CTACTCAGGAGGCTTGAGGCAGG - Intronic
939911563 2:147989593-147989615 CTACTCAGGAGACTTGAGGCAGG + Intronic
940073287 2:149713252-149713274 CTACTCAGGAGGCTTGAGGCAGG + Intergenic
940701685 2:157052605-157052627 CAAGTTAGCAGACGTGAAACTGG + Intergenic
944084125 2:195824665-195824687 TGACTCAGGAGAAGGGAAGCAGG - Intronic
1169099277 20:2931827-2931849 CAACTCAGGAGGCCTGAGGGAGG - Intronic
1170478246 20:16738329-16738351 CTACTCAGGAGGCTTGAAGCAGG + Intronic
1173660234 20:44728099-44728121 CTACTCAGGAGTCTTGAGGCAGG - Intronic
1174117513 20:48237425-48237447 CTTCTCAGGAGAAGGGAAGCAGG - Intergenic
1176009328 20:62883892-62883914 CTACTCAGGAGGCTTGAGGCAGG + Intronic
1176903683 21:14474408-14474430 CAACACAGGTTACATGAAGCTGG - Intergenic
1177032153 21:15994332-15994354 CAACTCAGTCGACGTGCAGGAGG + Intergenic
1181946926 22:26525322-26525344 CTACTCAGGAGGCTTGAACCTGG - Intergenic
1182908056 22:33955918-33955940 CAAATGAGGAGAGCTGAAGCAGG - Intergenic
1184310911 22:43642050-43642072 CTACTCAGGAGGCTTGAGGCAGG - Intronic
1185004138 22:48265428-48265450 CAACACATGGGCCGTGAAGCAGG - Intergenic
1185299280 22:50071200-50071222 CTACTCAGGAGGCTTGAACCTGG - Intronic
949584902 3:5427922-5427944 CAAGTCAGGAGTCCTGAACCTGG - Intergenic
950171394 3:10841330-10841352 CAACTCCGGAGACTTGGAGAAGG - Intronic
950409165 3:12823616-12823638 CTACTCAGGAGGCTTGAGGCAGG + Intronic
950507070 3:13401597-13401619 CCACACAGGAGACAAGAAGCAGG + Intronic
951783820 3:26395935-26395957 CATCTCCGGAGAAGAGAAGCAGG + Intergenic
953011304 3:39027846-39027868 CTCTTCAGGAGACTTGAAGCTGG - Intergenic
955258662 3:57361236-57361258 CTACTCAGGAGTCCTGAGGCAGG + Intronic
955906796 3:63815865-63815887 CAAGCGAGGAGGCGTGAAGCCGG + Intergenic
957529367 3:81421437-81421459 CAATTCACGAGACGTGAAACAGG + Intergenic
958788258 3:98622684-98622706 CTACTCAGGAGGCCTGAGGCAGG - Intergenic
961717571 3:128869182-128869204 CTACTCAGGAGACTTGAGGTGGG - Intergenic
965205167 3:165712938-165712960 GCACTCAGGAGATGTGAAGTGGG + Intergenic
965386479 3:168052061-168052083 CACCTCATGAGAAATGAAGCTGG - Intronic
966951138 3:184818919-184818941 CTACTTGGGAGACGTGAAGTAGG + Intronic
967165656 3:186777164-186777186 CAACTCAGGATGTGTGAAGGAGG + Intergenic
967517553 3:190388173-190388195 CAACTCAAGACACCTGCAGCAGG + Exonic
967872223 3:194239988-194240010 CTACTCAGGAGGCTTGAGGCAGG + Intergenic
969260320 4:6029257-6029279 CATCCCAGAAGACGTGAGGCTGG - Intronic
969312606 4:6362650-6362672 CAACTCAGCAGAAGTGGAGATGG - Intronic
974823922 4:67102786-67102808 CATCCCAGGAGAGATGAAGCAGG + Intergenic
976921412 4:90448990-90449012 CCTCTCAGGAGACCTGAAGTTGG + Intronic
976979807 4:91213393-91213415 CAACTTTGTAGACTTGAAGCTGG - Intronic
979473837 4:121131743-121131765 CTACTCAGGAGGCTTGAGGCGGG - Intronic
981602598 4:146507447-146507469 CTACTCAGGAGGCTTGAGGCAGG + Intronic
982022403 4:151215935-151215957 CTACTCAGGAGGCTTGAGGCAGG - Intronic
984755216 4:183319798-183319820 CAACCCAAGAGACGGGAACCAGG + Exonic
984755427 4:183322006-183322028 CAACCCAAGAGACGGGAACCAGG + Exonic
985293713 4:188412316-188412338 CGACTGAGGAGACATGAAGCAGG + Intergenic
986468992 5:8055471-8055493 GAAGCCAGGAGACATGAAGCTGG - Intergenic
988479929 5:31620975-31620997 CTACTCAGAAGACTTGAACCAGG + Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
993638762 5:90377377-90377399 CTACTCAGGAGGCCTGAGGCAGG + Intergenic
994357443 5:98809906-98809928 CTACTCAAGAGGCTTGAAGCAGG - Intergenic
995275589 5:110274264-110274286 CTACTCAGGAGGCTTGAGGCAGG - Intergenic
995375389 5:111468545-111468567 ATACTTAGGAGACTTGAAGCTGG + Intronic
995709179 5:115017399-115017421 GTACTCAGGAGGCCTGAAGCAGG + Intergenic
995990400 5:118231540-118231562 CTACTCAGGAGGCTTGAAGCAGG - Intergenic
996893431 5:128451509-128451531 CTACTCAGGAGGCCTGAGGCAGG - Intronic
997175453 5:131771683-131771705 CAACTCTGTAGACGTGGAGAGGG - Intronic
998194080 5:140051588-140051610 CAACTCTGGGGGCGTGAAGCAGG + Intergenic
999152014 5:149432629-149432651 CAGCTAAGAAGTCGTGAAGCTGG + Intergenic
1000133442 5:158321587-158321609 CAACTCTGGATAACTGAAGCAGG - Intergenic
1000482879 5:161801702-161801724 AAACAGAGGAGAGGTGAAGCAGG + Intergenic
1002008505 5:176256851-176256873 CTACTCAGGAGACTTGAGGCAGG - Intronic
1002218218 5:177655403-177655425 CTACTCAGGAGACTTGAGGCAGG + Intergenic
1002256321 5:177960975-177960997 CAAATGAGAAGACGTGGAGCAGG + Intergenic
1003313398 6:4988305-4988327 CAACTAAGGAAATGTGAATCAGG - Intergenic
1006139364 6:31918787-31918809 CTACTCAGGAGGCTTGAACCTGG + Intronic
1007095799 6:39212176-39212198 CTACTCAGGAGGCTTGAGGCAGG + Intronic
1007575222 6:42921210-42921232 CTACTCAGGAGGCTTGAAGCAGG - Intronic
1011946532 6:92911271-92911293 CTACTCAGGAGGCTTGAGGCAGG + Intergenic
1014065710 6:117122841-117122863 AAACTCAGGAAACGAGATGCTGG - Intergenic
1016277657 6:142373648-142373670 CTACTCAGGAGAGCTGAAGTAGG - Intronic
1018541782 6:164888526-164888548 CAAGTCAGGAGAGGTTAAGAGGG + Intergenic
1018579629 6:165297308-165297330 CTACTCAGGAGGCTTGAACCCGG + Intronic
1018720533 6:166568504-166568526 CTACTCAGGAGGCTTGAGGCAGG + Intronic
1019094517 6:169567919-169567941 CCACTCTGCAGACGTAAAGCTGG + Intronic
1022286808 7:28961396-28961418 CTACTCAGGAGGCTTGAGGCAGG - Intergenic
1023300531 7:38766184-38766206 AACCTCAGGAGACGAGAAGCAGG + Intronic
1024983455 7:55176606-55176628 CCACTCAGGAGATGGGAAGATGG + Intronic
1025806492 7:64838406-64838428 CAACTCAGGACACGGCCAGCCGG - Intergenic
1026428957 7:70325007-70325029 CAACTCAGGAGAGATGAGCCAGG + Intronic
1027181699 7:75945168-75945190 CTACTCAGGAGGCCTGAGGCAGG + Intronic
1032096487 7:128940765-128940787 CAACCCAGGAGAGGTAAGGCCGG - Intronic
1034333102 7:150300238-150300260 CTACTCAGGAGGCTTGAGGCAGG + Intronic
1034599958 7:152241309-152241331 CTACTCAGGAGACTTGAGGCAGG - Intronic
1034664941 7:152809651-152809673 CTACTCAGGAGGCTTGAGGCAGG - Intronic
1036370159 8:8155644-8155666 CAACTCAGGAGGCATCAAGGAGG + Intergenic
1036880733 8:12509987-12510009 CAACTCAGGAGGCATCAAGGAGG - Intergenic
1038212474 8:25532227-25532249 CTACTCAGGAGGCTTGAGGCAGG + Intergenic
1041332483 8:56741667-56741689 CAACTCAGGAGGCCAGAAGTTGG - Intergenic
1041982826 8:63882627-63882649 CTACTCAGGAGGCTTGAGGCAGG - Intergenic
1042581970 8:70289943-70289965 CTACTCAGGAGCCTTGAGGCAGG - Intronic
1044270852 8:90241527-90241549 CAACTCTGGAAATATGAAGCAGG + Intergenic
1045026777 8:98094989-98095011 CTACTCAGGAGAGGTGAGGTGGG - Intergenic
1046730000 8:117714420-117714442 CAACTCAGAAGTAGTGGAGCTGG + Intergenic
1047990550 8:130281953-130281975 CTACTCGGGAGACTTGAGGCAGG + Intronic
1048106259 8:131413594-131413616 CCGCTCAGGAGAAGTGGAGCTGG + Intergenic
1049883363 9:12755-12777 CAGCTCTGGAGACCTGATGCTGG - Intergenic
1052729135 9:32264830-32264852 CTGCTCAGGAGTCATGAAGCCGG - Intergenic
1056639053 9:88354785-88354807 CTACTCAGGAGACTTGAACCTGG - Intergenic
1057746803 9:97758897-97758919 CAACCTAGGAGACCTCAAGCTGG - Intergenic
1060699999 9:125742415-125742437 CTACTCAGGAGCCCTGAGGCAGG + Intergenic
1061088309 9:128412044-128412066 CAACTCAGGAGACGTGAAGCTGG + Intronic
1061560467 9:131399163-131399185 CTACTCAGGAGGGGTGAGGCTGG + Intronic
1061743207 9:132722337-132722359 CAACTCAGGAGACCTGAACTGGG + Intergenic
1203584644 Un_KI270746v1:53812-53834 CTACTCAGGAGGCTTGAGGCAGG - Intergenic
1190458260 X:50645807-50645829 GTACTCAGGAGACGTGAACTTGG + Intronic
1194666346 X:96681740-96681762 CTACTCAGGAGGCTTGAGGCAGG - Intergenic
1200402452 X:156027393-156027415 CAGCTCTGGAGACCTGATGCTGG + Intergenic
1200455650 Y:3388204-3388226 CTACTCAAGAGACTTGAGGCAGG - Intergenic
1201501513 Y:14648294-14648316 CTACTCAGGAGGCTTGAGGCAGG + Intronic