ID: 1061089957

View in Genome Browser
Species Human (GRCh38)
Location 9:128420888-128420910
Sequence CTGGAGCAGCGGCGCGGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 230}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061089957_1061089966 5 Left 1061089957 9:128420888-128420910 CCCGCGCCGCGCCGCTGCTCCAG 0: 1
1: 0
2: 1
3: 29
4: 230
Right 1061089966 9:128420916-128420938 GCTCCTGCTGGGGCCGTGGCTGG 0: 1
1: 0
2: 6
3: 57
4: 543
1061089957_1061089970 15 Left 1061089957 9:128420888-128420910 CCCGCGCCGCGCCGCTGCTCCAG 0: 1
1: 0
2: 1
3: 29
4: 230
Right 1061089970 9:128420926-128420948 GGGCCGTGGCTGGAGGCTGCGGG 0: 1
1: 0
2: 6
3: 74
4: 670
1061089957_1061089968 8 Left 1061089957 9:128420888-128420910 CCCGCGCCGCGCCGCTGCTCCAG 0: 1
1: 0
2: 1
3: 29
4: 230
Right 1061089968 9:128420919-128420941 CCTGCTGGGGCCGTGGCTGGAGG 0: 1
1: 0
2: 2
3: 66
4: 684
1061089957_1061089961 -7 Left 1061089957 9:128420888-128420910 CCCGCGCCGCGCCGCTGCTCCAG 0: 1
1: 0
2: 1
3: 29
4: 230
Right 1061089961 9:128420904-128420926 GCTCCAGCTGCTGCTCCTGCTGG 0: 1
1: 2
2: 20
3: 264
4: 1016
1061089957_1061089962 -6 Left 1061089957 9:128420888-128420910 CCCGCGCCGCGCCGCTGCTCCAG 0: 1
1: 0
2: 1
3: 29
4: 230
Right 1061089962 9:128420905-128420927 CTCCAGCTGCTGCTCCTGCTGGG 0: 1
1: 3
2: 14
3: 151
4: 785
1061089957_1061089963 -5 Left 1061089957 9:128420888-128420910 CCCGCGCCGCGCCGCTGCTCCAG 0: 1
1: 0
2: 1
3: 29
4: 230
Right 1061089963 9:128420906-128420928 TCCAGCTGCTGCTCCTGCTGGGG 0: 1
1: 1
2: 13
3: 148
4: 942
1061089957_1061089972 23 Left 1061089957 9:128420888-128420910 CCCGCGCCGCGCCGCTGCTCCAG 0: 1
1: 0
2: 1
3: 29
4: 230
Right 1061089972 9:128420934-128420956 GCTGGAGGCTGCGGGCGTTGCGG 0: 1
1: 0
2: 2
3: 19
4: 334
1061089957_1061089965 1 Left 1061089957 9:128420888-128420910 CCCGCGCCGCGCCGCTGCTCCAG 0: 1
1: 0
2: 1
3: 29
4: 230
Right 1061089965 9:128420912-128420934 TGCTGCTCCTGCTGGGGCCGTGG 0: 1
1: 0
2: 7
3: 73
4: 600
1061089957_1061089969 14 Left 1061089957 9:128420888-128420910 CCCGCGCCGCGCCGCTGCTCCAG 0: 1
1: 0
2: 1
3: 29
4: 230
Right 1061089969 9:128420925-128420947 GGGGCCGTGGCTGGAGGCTGCGG 0: 1
1: 0
2: 9
3: 102
4: 1016

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061089957 Original CRISPR CTGGAGCAGCGGCGCGGCGC GGG (reversed) Exonic
900113523 1:1019552-1019574 CGGGAGCTGCGGCGCGGAGGCGG - Intergenic
900429315 1:2594421-2594443 CTGGATCATCGGGGCGGCGGTGG - Exonic
900490636 1:2947195-2947217 CTGGAGCAGCGGCCAGGCCCTGG - Intergenic
900574746 1:3377548-3377570 CTGGGGGAGCTGCCCGGCGCCGG + Intronic
900787028 1:4655616-4655638 CTGGAGCAGCACCGCGGCCCTGG + Intronic
900972388 1:5998730-5998752 CAGGAGCAGCGAGGGGGCGCAGG + Intronic
901628910 1:10638833-10638855 CGGAAGCACCGGCGGGGCGCGGG + Exonic
901703123 1:11055975-11055997 CTGGAGCACTGGGGCGGGGCGGG - Intronic
901977298 1:13005295-13005317 TTGGAGCAGCGGCTCAGGGCAGG - Intronic
902004788 1:13223639-13223661 TTGGAGCAGCGGCTCAGGGCAGG + Intergenic
902024007 1:13369374-13369396 TTGGAGCAGCGGCTCAGGGCAGG + Exonic
903750124 1:25616540-25616562 ATGGTCCAGCGGCGCGGGGCAGG - Intergenic
903950662 1:26994236-26994258 CCTGAGCGGCGGCGTGGCGCAGG + Exonic
904237341 1:29123856-29123878 CTGGCGCCGCAGCGCCGCGCGGG + Intronic
905449324 1:38046756-38046778 CGGCGGCGGCGGCGCGGCGCAGG - Exonic
908534755 1:65067148-65067170 CGGGGGCGGCGGCGCGGGGCGGG - Intergenic
908714285 1:67053743-67053765 CGGCGGCGGCGGCGCGGCGCCGG - Intronic
910657567 1:89633588-89633610 CTGCCGCTGCGGCGCGGCGTTGG - Intronic
913109082 1:115641927-115641949 CTCGGGCTGCGGGGCGGCGCCGG + Intergenic
917027620 1:170660617-170660639 CTGCAGGAGCGGCGCTGCACAGG + Intergenic
917666385 1:177229810-177229832 CTGGAGGAGCAGCACGGAGCGGG + Exonic
918388645 1:184036569-184036591 CTGGAGCAGGAGCCCGGCACCGG + Intronic
923506553 1:234610019-234610041 GTGGAGCTCGGGCGCGGCGCGGG + Intergenic
923631057 1:235649826-235649848 CGGGAGGCGCGGCGCGGGGCGGG - Exonic
923785087 1:237058787-237058809 CTGGAGAAGGGGCGGGGGGCCGG + Intronic
924436822 1:244049286-244049308 GTGCAGCTGCGGCGCGGGGCGGG + Intronic
924552928 1:245095138-245095160 CTGCAGCAGCGGCCCTGCACGGG - Intronic
924659861 1:246006315-246006337 CTGGAGGGGCGGCGGGGGGCGGG + Intronic
1062829357 10:595128-595150 CTGCAGCAAAGGCGAGGCGCAGG + Intronic
1065188871 10:23192964-23192986 CGGCTGCGGCGGCGCGGCGCCGG + Exonic
1066080907 10:31929201-31929223 CTGGAGCTGCGGCCGGGCGTGGG + Intergenic
1067056370 10:43054726-43054748 CTGGAGCAGAGGTGGGGCCCTGG + Intergenic
1070329183 10:75405659-75405681 CAGGAGCCGCGGCCCGGCCCGGG + Intergenic
1072465248 10:95656786-95656808 CTGGAGCTGCGGCGCGGCAATGG + Intergenic
1073098893 10:100997053-100997075 CTGGTGGAGCGGGGCGGGGCGGG - Intronic
1073111785 10:101066932-101066954 CTGCAGCAGAGGCGGGGTGCGGG - Intronic
1073292924 10:102422138-102422160 CTGGCGCAGAGGCGCGGCGCTGG + Exonic
1073392845 10:103193324-103193346 CGCGAGCAGAGGGGCGGCGCGGG - Intergenic
1075422008 10:122308780-122308802 CTGGAGCAGCTGAGCTGGGCAGG - Intronic
1075766650 10:124898731-124898753 CTGGAGCATCGGCGAGGCTGGGG + Intergenic
1076217723 10:128710102-128710124 ACGGAGCAGCAGCGCGGCCCGGG - Intergenic
1076311821 10:129513508-129513530 CTGGAGCAGCAGCTCAGAGCAGG + Intronic
1076761427 10:132607801-132607823 CAGGAGCAGAGGCGCAGCCCGGG - Intronic
1077090696 11:777121-777143 TCGGAGGAGCGACGCGGCGCCGG + Intronic
1079128501 11:17734835-17734857 CGGCAGCAGCGTCGCGGCGGCGG + Exonic
1083442726 11:62687809-62687831 CTCGGGCGGCGGCTCGGCGCGGG + Exonic
1083814030 11:65121980-65122002 CTGGAGCAGGGCCACGGAGCAGG + Intronic
1084295841 11:68213140-68213162 GAGGAGGAGCGGGGCGGCGCAGG - Exonic
1084522910 11:69675353-69675375 CGGAAGCGGCGGCGCGGGGCAGG + Intronic
1084931839 11:72562150-72562172 CTGCAGCAGTGGCGGGGCTCAGG - Intergenic
1088629989 11:111765867-111765889 CTGGAGCGGCTGAGGGGCGCAGG - Intronic
1090080401 11:123608781-123608803 ATGGAGCAGCGGCGCTTCTCTGG + Exonic
1091558666 12:1594404-1594426 CGGGCGGAGCGGCGCGGCCCGGG - Intronic
1092522949 12:9292320-9292342 TTGGGGCAGCAGCGCGGCGCAGG - Intergenic
1092544342 12:9439577-9439599 TTGGGGCAGCAGCGCGGCGCAGG + Intergenic
1094508606 12:31082490-31082512 TTGGGGCAGCAGCGCGGCGCAGG - Intronic
1096790728 12:54043174-54043196 CTGGAGCAGTGGACCGGCTCAGG - Intronic
1096791390 12:54047344-54047366 CTGCAGCGGCCCCGCGGCGCGGG - Intronic
1097107667 12:56634945-56634967 CTGGAGCAGGGCCGGGCCGCAGG + Intronic
1097192314 12:57225407-57225429 CAGCAGCAGCGGCGGGGCCCGGG + Exonic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1104289650 12:127455843-127455865 CTGGGGCGGCTGCGGGGCGCGGG + Intergenic
1104658496 12:130591932-130591954 CTGGGGCAGTGGTGCAGCGCAGG - Intronic
1105240830 13:18608997-18609019 CTGGAGCGAAGGCGCGGAGCAGG - Intergenic
1105745636 13:23375211-23375233 CTGCAGGACCGTCGCGGCGCTGG - Exonic
1108676078 13:52739121-52739143 CTTGAGCAGCCGCGCGGGGCTGG + Exonic
1113460411 13:110478542-110478564 CTGGAGCAGAGGAGCGGGGAGGG + Intronic
1114269225 14:21091035-21091057 CGGGAGCAGAGGAGCGGGGCCGG - Exonic
1115257762 14:31420664-31420686 TTGGACCAGCGGCCCGGCGCAGG - Intronic
1115687248 14:35809014-35809036 TTGGAGCCGCGGCGCGAGGCGGG - Exonic
1116895673 14:50312625-50312647 CTGGAGCGGGGGCGGGGCGGGGG - Exonic
1117899127 14:60515118-60515140 CGGGGGTAGCCGCGCGGCGCAGG - Intronic
1118285260 14:64465373-64465395 CCGGAGGCGCGGGGCGGCGCGGG - Intronic
1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG + Intronic
1119808772 14:77499256-77499278 CTGGACCGGCGGTGCCGCGCGGG + Intergenic
1122081690 14:99271290-99271312 CGGCGGCAGCGGCGCGGCGGCGG - Intronic
1123490526 15:20776143-20776165 CTGGAGCGAAGGCGCGGAGCAGG + Intergenic
1123547028 15:21345230-21345252 CTGGAGCGAAGGCGCGGAGCAGG + Intergenic
1124637091 15:31372198-31372220 ATGCTGCAGCGGCGCGGCGGGGG + Exonic
1125720998 15:41845111-41845133 CTGGAGCTGGGGCTCGGTGCTGG + Intronic
1125880057 15:43185717-43185739 CTGGGGCGGCGGCGGGGAGCCGG + Intronic
1127257871 15:57306921-57306943 CAGGGGCAGGGGCGCGGGGCTGG - Intergenic
1127893704 15:63277243-63277265 CAGGAGCTGCGGCGTGGCCCTGG + Intronic
1128264168 15:66253259-66253281 CGAGAGCAGTGGCGCGGCGCGGG - Intronic
1128423959 15:67521143-67521165 CTCGGGCACCCGCGCGGCGCCGG + Exonic
1129521990 15:76191923-76191945 CTGAATCAGCGGCGAGGGGCCGG - Intronic
1129889734 15:79063942-79063964 CTGGAGCAGAGGGGAGGAGCAGG + Intronic
1130224160 15:82045252-82045274 CCAGGGCAGCGGCGCGGCTCCGG + Intronic
1130305326 15:82709426-82709448 CTGGAGCCCCGGCCCAGCGCGGG - Intronic
1130380252 15:83365728-83365750 CTGGAGAAGCGGCCGGACGCAGG - Intergenic
1132055535 15:98648446-98648468 CCGCAGCAGCGGCGCGCCGAGGG - Intergenic
1202955359 15_KI270727v1_random:72446-72468 CTGGAGCGAAGGCGCGGAGCAGG + Intergenic
1132622066 16:872562-872584 CTGGACCAGCGGAGGGGAGCTGG - Intronic
1133073424 16:3262032-3262054 CTGGAGCAGAGGCACGGAGGAGG + Intergenic
1133115753 16:3577151-3577173 CTGGAGCAGCATCGAGGCCCGGG - Exonic
1133188519 16:4116575-4116597 CTGGGGCTGCGGGGCGGGGCGGG + Intergenic
1134172081 16:11976762-11976784 CAGCGGCGGCGGCGCGGCGCAGG + Exonic
1136479963 16:30534917-30534939 CTGGAGCGGGGGCGCGGGGAGGG - Intronic
1136498814 16:30659609-30659631 CGGGAGCAGCGGCGCCGCCGAGG + Exonic
1137267988 16:46884399-46884421 CTGGAGCAGCTACCCGGCCCCGG - Exonic
1138510867 16:57507811-57507833 CTGGGCCAGCGGAGCGGGGCTGG - Intergenic
1139650117 16:68357991-68358013 CTGGTGAAGCGGCGCTGGGCAGG - Exonic
1139668148 16:68472603-68472625 CTGGAGCAGCTGAGGGGCTCTGG + Intergenic
1140820492 16:78658560-78658582 CTGGAGGAGAGGCACGGAGCAGG - Intronic
1141533363 16:84661862-84661884 GTGCAGCAGCGGCGCCACGCGGG - Exonic
1142376801 16:89710803-89710825 CTGGGGCCGCGGGGCTGCGCTGG + Exonic
1142610725 17:1108252-1108274 CTTGAGGAGCGGGGCGGCCCCGG - Intronic
1142836813 17:2593662-2593684 CTGGAGCGGCGGGGCGGCGGCGG + Intronic
1143007361 17:3845866-3845888 CTGGAGGAGGGACGCGGAGCGGG - Intronic
1143334690 17:6163387-6163409 CTGGAGAAGAGGTGCGGAGCTGG + Intergenic
1145243586 17:21253271-21253293 GCGGGGCTGCGGCGCGGCGCCGG + Exonic
1146935097 17:36808301-36808323 CTGGAGCACCCGCGCGGCTGTGG - Intergenic
1147672404 17:42184215-42184237 CCGAGGCAGGGGCGCGGCGCTGG + Exonic
1148271763 17:46267020-46267042 CTGAAGCTGAGGCGCGGCGGCGG - Intergenic
1148722650 17:49764482-49764504 CTGGAGAGTGGGCGCGGCGCTGG + Intronic
1148836569 17:50468844-50468866 CAGCAGCGGCGGCGGGGCGCGGG + Exonic
1149461699 17:56834268-56834290 TTCGAGGACCGGCGCGGCGCAGG + Intronic
1149916396 17:60613798-60613820 CTGGCCCACCGGCGCTGCGCTGG + Intronic
1150311056 17:64129899-64129921 CCGGGGCAGCGTCGCGGCGCCGG - Intronic
1150983565 17:70169781-70169803 CTGGAGCAGCGGGGCAGGGTAGG - Intronic
1152070490 17:78131664-78131686 ATGGAGCGGCTGCGCGGCTCTGG + Exonic
1152588658 17:81200369-81200391 CAGGTGCAGCGGCGCGGAGCAGG - Exonic
1152619038 17:81352224-81352246 CCGGCGCACCGGCGCTGCGCTGG - Intergenic
1152663163 17:81552304-81552326 GCGGACCCGCGGCGCGGCGCCGG + Exonic
1154151438 18:11909062-11909084 CCGGAGGGGCAGCGCGGCGCGGG - Exonic
1154448139 18:14450910-14450932 CTGGAGCGAAGGCGCGGAGCAGG + Intergenic
1158514714 18:58121467-58121489 CTGGAGCAGTGGTGTGGCCCTGG + Intronic
1160321497 18:77900253-77900275 CAGGGGCGGTGGCGCGGCGCTGG + Intergenic
1160456183 18:79003074-79003096 CTGCAGCAGCGGCGTGACGGGGG - Intergenic
1160919539 19:1513249-1513271 CTCGGGCGGGGGCGCGGCGCGGG + Intronic
1161150080 19:2702805-2702827 CCGGAGCGGGGGCGGGGCGCGGG + Intergenic
1161424779 19:4197195-4197217 CTGGGGCAGGGGCGGGGTGCTGG + Intronic
1162953535 19:14085743-14085765 CCGGAGCCGCGCCGCCGCGCCGG + Exonic
1162953534 19:14085743-14085765 CCGGCGCGGCGGCGCGGCTCCGG - Exonic
1163544498 19:17933085-17933107 GGGGAGCAGAGGCGCGGGGCGGG + Intronic
1164722990 19:30445564-30445586 CTGGATGAGCGGCGTGGCTCGGG + Exonic
1164958236 19:32405378-32405400 CCGGAGCAGCGGCTCCGCGGTGG - Intergenic
1165204522 19:34172460-34172482 CTCAAGCCGCGGCGCGGCGGCGG - Intergenic
1167437194 19:49486345-49486367 CTGGAGCCCCGGGCCGGCGCTGG + Intergenic
1168594473 19:57664346-57664368 GAGGAGCTGGGGCGCGGCGCGGG + Intergenic
926018450 2:9474546-9474568 ATGGAGCAGCCGGGCGGGGCGGG - Exonic
929460994 2:42101916-42101938 CTGGAGGAGAGGCGAGGGGCAGG - Intergenic
929665131 2:43827990-43828012 CTGGAGCAGCTGGGCTGCGATGG + Exonic
930991028 2:57655025-57655047 CTGGAGCAGCGGCCCTCCCCTGG + Intergenic
931516315 2:63052348-63052370 CTGGGGCAGGGGCGCAGCCCTGG + Intronic
933655156 2:84880968-84880990 CGGGCGCAGCTTCGCGGCGCGGG - Exonic
933886118 2:86720441-86720463 CGGGAGCAGCGGCGACTCGCCGG + Exonic
934614614 2:95763364-95763386 CTGGAGCAGCTGCGTAGCCCAGG + Intergenic
934754765 2:96817148-96817170 CTGGAGCTGGCGCGCGGCGGCGG + Exonic
937375893 2:121335416-121335438 CTGTAGCGGCGGCGCTGCCCGGG + Intergenic
939368364 2:141265009-141265031 CAGGAGCAGCGGCTCAGCACAGG - Intronic
943185167 2:184598315-184598337 CTGCGGCAGCGGCGCCGCGCGGG + Intergenic
948121695 2:235535636-235535658 CTGGAGCTGGAGCGCGACGCGGG - Intronic
1170756808 20:19212494-19212516 CTGGGGCGGCGGCGCGGCGGGGG - Intergenic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1171973417 20:31578739-31578761 CTGGCCCACCGGCGCTGCGCTGG - Intergenic
1172083229 20:32358700-32358722 CTGGGGCGGTGGCGCGGGGCTGG - Exonic
1172474399 20:35226542-35226564 CAGGGGCCGCGGAGCGGCGCTGG - Intergenic
1173322382 20:41999400-41999422 CTGGAGCAGGTGCGCGGGGCCGG + Intergenic
1174204282 20:48827862-48827884 CTAGCGCGGCCGCGCGGCGCCGG + Exonic
1175267073 20:57709585-57709607 ACGGCGCGGCGGCGCGGCGCGGG + Exonic
1175888834 20:62307212-62307234 CTGGAGGAGCGGCGTGGGGCGGG - Intronic
1176042375 20:63072334-63072356 CGGGGGCAGCAGCGGGGCGCGGG + Intergenic
1179833290 21:44011985-44012007 GGGGAGCAGCGGCCCGCCGCGGG + Intergenic
1183370132 22:37427498-37427520 CAGGGGCAGAGGCGCGGCGGCGG - Intergenic
1184079894 22:42211987-42212009 CTGGAGCAGCGGTTCTGCTCAGG - Exonic
1184361910 22:44024136-44024158 CTTGAGCGGCGGCGCGGGACGGG + Intronic
1185055156 22:48575530-48575552 CCGGAGCAGCGGCGTCCCGCGGG + Intronic
1185317635 22:50185887-50185909 CTGGGGCCGCGGGGCGGGGCGGG - Intergenic
1185375618 22:50481577-50481599 CTGGAGCGGAGTCGCGGCCCGGG - Exonic
1185397485 22:50600480-50600502 CTGGAGGACCCGCGCGGGGCGGG - Intronic
950040263 3:9915518-9915540 GGCGAGCAGGGGCGCGGCGCGGG - Exonic
950053922 3:10010894-10010916 CTGGAGCAGCCGCGCCCGGCGGG + Intronic
950453850 3:13080765-13080787 CTGGAACAGCGGCAGGGCGGGGG - Intergenic
951016965 3:17742328-17742350 CTGCAGCAGCGGCGCGAAGGGGG + Intronic
951998452 3:28757209-28757231 CTGGAGCAGCGGCGGGAGGCAGG + Intergenic
960556326 3:119034690-119034712 GGGGAACAGCGGCCCGGCGCTGG - Exonic
960977955 3:123194769-123194791 CTGGGGCGGCGGGGCGGGGCGGG - Intronic
961012885 3:123448046-123448068 CTGGAGGAGCGGCGGGGCAAGGG - Exonic
962720990 3:138174710-138174732 CTGGCAGAGCGGCGCGGCCCGGG - Exonic
962770918 3:138609230-138609252 GTGGAGGTGCGGCGGGGCGCGGG + Intronic
966846614 3:184135436-184135458 CAAGCGCAGCGGCGCGGGGCCGG + Exonic
967055411 3:185825366-185825388 GGGGCGCAGCGGCGCGGGGCGGG - Intergenic
968372810 4:11224-11246 CCGGGGCGGGGGCGCGGCGCAGG + Intergenic
968372819 4:11261-11283 CCGGGGCAGGGGCGCGGCGCAGG + Intergenic
968549368 4:1214368-1214390 CCGGATCCGCGGCGCGGCCCTGG - Exonic
968552961 4:1233466-1233488 CTGGAGCGGCAGGGCGGCTCCGG - Intronic
968638441 4:1696129-1696151 CTGGAGCAGCTGCGCACCACTGG - Intronic
969246126 4:5934035-5934057 CTGGAGCAGCAGCGTGGTGTAGG + Intronic
985462576 4:190121306-190121328 CCGGGGCGGGGGCGCGGCGCAGG - Intergenic
985462586 4:190121343-190121365 CCGGGGCGGGGGCGCGGCGCAGG - Intergenic
985462598 4:190121380-190121402 CCGGAGCGGGGGCGCGGCGCAGG - Intergenic
986299726 5:6468325-6468347 CTGGAGCAGGGGCGCGGGGTGGG + Intronic
987258394 5:16179869-16179891 AGGGAGGAGCGGCGCGGCGGGGG + Intronic
991590316 5:68244520-68244542 CTGAAGCGGCGGCGGGGGGCGGG - Intronic
995725471 5:115177616-115177638 CTGGGGCTGCGGGGCGGGGCAGG + Intronic
998136543 5:139677085-139677107 CTGGCGGGGCGGCGGGGCGCTGG + Intronic
998583579 5:143404060-143404082 CTGGAGCCGCGGAGCTGGGCGGG - Intronic
1001483792 5:172105656-172105678 CTCCAGCAGCTGCGCGGCACTGG + Exonic
1003995717 6:11537930-11537952 CAGGGGCAGCGCCGCGCCGCGGG - Intergenic
1005928908 6:30466345-30466367 CCGGAGGAGCGCCGCGGAGCAGG - Intergenic
1005952596 6:30642811-30642833 CTGGAGGTGTGGCGCGGCGAGGG - Exonic
1006303886 6:33207834-33207856 CAGGAGCCGCGGCCCGGGGCGGG - Intergenic
1012916880 6:105179997-105180019 CCGGAGCGGCGCGGCGGCGCGGG + Intergenic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1017324578 6:153130961-153130983 CGGGGGCGGCTGCGCGGCGCTGG - Intronic
1017672095 6:156778153-156778175 CTGGTGGGGCGGCGCGGCGGGGG - Exonic
1017793637 6:157823069-157823091 CCGGGGCGGCGGCGCGGCGCGGG + Intronic
1018030299 6:159836552-159836574 CTCGAGCAGCCGCGCGGGGGAGG + Intergenic
1018702958 6:166441856-166441878 CTGGAGCAGCTGCCGGGGGCCGG + Intronic
1018788981 6:167131584-167131606 CTGCAGCAGGGGCGCGGCTCTGG - Intronic
1020162137 7:5781137-5781159 CTGGAGGAGCGGCGGGAGGCGGG - Intronic
1020278205 7:6637239-6637261 CGGGGGCAGCGGCGCGGAGCGGG - Intergenic
1022485028 7:30771443-30771465 CTGGTGCTGCGGCCCGGCGTGGG + Exonic
1025106559 7:56175502-56175524 CGGGAGGAGCGCGGCGGCGCGGG + Intergenic
1026732651 7:72925144-72925166 CTGGAGCAGGCGAGCGGCGGCGG + Intronic
1027111413 7:75442675-75442697 CTGGAGCAGGCGAGCGGCGGCGG - Intronic
1027283642 7:76627208-76627230 CTGGAGCAGGCGAGCGGCGGCGG - Exonic
1029423547 7:100483791-100483813 CGGGAGCGGCCGTGCGGCGCGGG - Intergenic
1029506480 7:100966472-100966494 CAGCACCAGCAGCGCGGCGCCGG - Exonic
1029640580 7:101816871-101816893 CCGGAGCGGCGGCGCGGCCCGGG - Intronic
1030138855 7:106285051-106285073 CGGGAGCCGTGACGCGGCGCGGG + Exonic
1030884754 7:114922995-114923017 AGGCGGCAGCGGCGCGGCGCGGG + Exonic
1031483447 7:122304021-122304043 CTGCAGCGGCAGCGCGTCGCGGG + Exonic
1034445933 7:151114525-151114547 CGGGAACGGCGGCGCGGCGCGGG - Intronic
1034534188 7:151716796-151716818 CTGGAGCAGCTGCGTGGCTCAGG - Intronic
1034560624 7:151877328-151877350 CTGGGGCCGCGGCGCGGCGGGGG - Intergenic
1035752000 8:2002716-2002738 CGGCAGCCGCGGCGAGGCGCAGG + Exonic
1037947798 8:22999969-22999991 CAGCAGCAGCGCGGCGGCGCCGG + Intronic
1039915077 8:41854137-41854159 CTGGAGCAGCGACCCGCTGCAGG - Intronic
1045459316 8:102412486-102412508 CGGGACCAGGGGCGCGCCGCCGG + Exonic
1049388057 8:142354201-142354223 CTGCACCAGCTGCGCGGCCCTGG + Intronic
1049523655 8:143108947-143108969 CTGGATTAGTGGGGCGGCGCGGG - Intergenic
1049668430 8:143859076-143859098 CTGGAGCTGCGGCCGGGCCCCGG + Exonic
1049668849 8:143860684-143860706 CTGGAGCTGCGGCCGGGCCCCGG + Exonic
1049669264 8:143862286-143862308 CTGGAGCTGCGGCCGGGCCCCGG + Exonic
1049669676 8:143863879-143863901 CTGGAGCTGCGGCCGGGCCCCGG + Exonic
1049670091 8:143865487-143865509 CTGGAGCTGCGGCCGGGCCCCGG + Exonic
1053350491 9:37410642-37410664 CTGGAGCAGAGGCTTGGCTCTGG + Intergenic
1056386351 9:86099813-86099835 CCTGAGCAGCGACGCGGAGCGGG + Intronic
1056799535 9:89681478-89681500 CGGGGGCAGCGGTGCGGCGGGGG - Intergenic
1057199898 9:93134318-93134340 CTGGGGCAGCAGCTCGCCGCCGG - Intergenic
1057208073 9:93184972-93184994 ATGGAGCCCGGGCGCGGCGCGGG + Exonic
1058492780 9:105519932-105519954 TTGGAGCCGCGGCGCGAGGCGGG + Intronic
1059414987 9:114156736-114156758 CAGGAGCGGCTGCGCGGAGCTGG + Intronic
1060263169 9:122093190-122093212 CTGGGGCGGCGGAGCGGCGGCGG - Exonic
1060596873 9:124853763-124853785 CTGGAGCTGGGGCCCGGCACTGG - Intronic
1061089957 9:128420888-128420910 CTGGAGCAGCGGCGCGGCGCGGG - Exonic
1061208698 9:129178476-129178498 CTGGGGCTGCCGCGCCGCGCGGG + Intergenic
1061898090 9:133658841-133658863 CGGGAGCAGCGGGGCGGGGGCGG - Exonic
1061900682 9:133670620-133670642 CTGGAGCAGCAGCGGGCCGCAGG - Exonic
1062195391 9:135270705-135270727 CTGAAGCAGCGGCTGGGCCCTGG + Intergenic
1062212973 9:135374418-135374440 CTGGAGAAGCGGCGAGCAGCAGG + Intergenic
1187061413 X:15790469-15790491 CTGGAGGGGCGGGGCGGTGCCGG + Exonic
1187226133 X:17376401-17376423 CCGGAGCGGCGCCGCGGGGCTGG - Intronic
1190265696 X:48826384-48826406 CAGGGGCAGGGGCGCGGCGCAGG + Intergenic
1190285301 X:48957467-48957489 CCGGCGCCGCGGCGCGGCGGAGG - Exonic
1197297497 X:124737036-124737058 CTGGAGCAGCTGGGCTGGGCTGG + Exonic
1199600764 X:149540077-149540099 CGGGAGAAGCGGGGCGGGGCAGG - Intergenic
1200128957 X:153830762-153830784 GGGGGGCAGCGGCGCGGCGGCGG + Intergenic
1201496928 Y:14598373-14598395 CTGGCCCACCGGCGCTGCGCTGG - Intronic