ID: 1061091310

View in Genome Browser
Species Human (GRCh38)
Location 9:128428152-128428174
Sequence CTGTGGGACCAGAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 455}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061091310_1061091320 15 Left 1061091310 9:128428152-128428174 CCTTTCTCCCTCTGGTCCCACAG 0: 1
1: 0
2: 3
3: 52
4: 455
Right 1061091320 9:128428190-128428212 CCCAGAGAAGACTGACATGTTGG 0: 1
1: 0
2: 2
3: 22
4: 211
1061091310_1061091323 23 Left 1061091310 9:128428152-128428174 CCTTTCTCCCTCTGGTCCCACAG 0: 1
1: 0
2: 3
3: 52
4: 455
Right 1061091323 9:128428198-128428220 AGACTGACATGTTGGGTCACTGG 0: 1
1: 0
2: 1
3: 5
4: 94
1061091310_1061091322 16 Left 1061091310 9:128428152-128428174 CCTTTCTCCCTCTGGTCCCACAG 0: 1
1: 0
2: 3
3: 52
4: 455
Right 1061091322 9:128428191-128428213 CCAGAGAAGACTGACATGTTGGG 0: 1
1: 0
2: 0
3: 14
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061091310 Original CRISPR CTGTGGGACCAGAGGGAGAA AGG (reversed) Intronic
900791457 1:4683717-4683739 CTGTGGGACAAGTGAGAGGAAGG - Intronic
900938846 1:5784800-5784822 CTGTGGGGCCAGGGGGACCAGGG - Intergenic
901165709 1:7220337-7220359 CTTTGGGCCCAGAGGAATAATGG + Intronic
901201335 1:7469062-7469084 TTCTGGGAACTGAGGGAGAATGG - Intronic
901447621 1:9317969-9317991 CTGTGGAACCAGAGGAAGCTGGG + Intronic
902187749 1:14738117-14738139 GTGTGGGGCCCAAGGGAGAAAGG - Intronic
902363959 1:15958804-15958826 CTGAGGGGCCAGGTGGAGAAGGG + Intronic
902394512 1:16125321-16125343 CTGTGGGCCGGGAGGGAGAGAGG + Intronic
902770069 1:18640789-18640811 CAGTGCGACCAGAGGGAGAGAGG + Intronic
903006291 1:20301074-20301096 CTCTGGGACCTCAGAGAGAAGGG + Intronic
903378651 1:22882246-22882268 CTGTGGGATCAGAGAGGGAAGGG - Intronic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
904163177 1:28536191-28536213 CTGTGGGAGGAGATTGAGAAGGG + Intronic
904318708 1:29682661-29682683 CAGTGGGGTCAGAGGGAGCAGGG - Intergenic
904563658 1:31414322-31414344 GTGTGGGGCCAGAGGGGGAGGGG - Intronic
904896460 1:33821774-33821796 CTGTGGGACCACAGTGGGGAGGG + Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905245927 1:36613264-36613286 CTGTGGCCACAGAGGCAGAAAGG - Intergenic
905282241 1:36856603-36856625 CTGTGGGACCACAGGTACCACGG + Intronic
906545478 1:46616756-46616778 CTGCGGGACCTGCAGGAGAAAGG - Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
911445631 1:97988147-97988169 CTGTGGGGTAAGAGGGAGAGAGG + Intergenic
913107709 1:115629697-115629719 CTCTGGAACCAGAAGGAAAAGGG - Intergenic
913813298 1:122927172-122927194 CTTTGGGGCCAAAGGCAGAAAGG + Intergenic
914334392 1:146701365-146701387 CGGAGGGAGCAGAGGGAGAGTGG - Intergenic
914807018 1:150999100-150999122 ATGTGGGAACAGAGAGAGAGAGG - Intronic
914850350 1:151309559-151309581 CTGTGGGACCAAAGGGTCAGGGG + Intronic
915049993 1:153058735-153058757 CTGTGGGACTAGAGGGTCTACGG - Intergenic
915115318 1:153594915-153594937 CTGATGGACCAGAGAGAGGAAGG - Intergenic
915275196 1:154783686-154783708 CTGTGGGACTGGAAGGAGAGGGG + Intronic
915487826 1:156234333-156234355 CTGTTGGTCCTGTGGGAGAAAGG + Intronic
915489323 1:156242626-156242648 CTGAGGGACCAGGGTGAGAGGGG - Intronic
916929130 1:169556680-169556702 CTGTGGGCCCAGAGGGAAAGTGG - Exonic
917494907 1:175531546-175531568 CAGAGGGACCCGAGGGAGAGGGG + Intronic
917709595 1:177670911-177670933 TGGTGGGCCCAGAGGGACAAAGG + Intergenic
917796677 1:178537923-178537945 CTCTGGGGCCAGAGGCAGAGAGG - Intronic
919102247 1:193109008-193109030 AGGTGGGGGCAGAGGGAGAAGGG + Intergenic
919972998 1:202592773-202592795 CCTTGGGACCAAAGGGAGAGGGG + Exonic
919974736 1:202603119-202603141 CTGTGGGAGCTGGGGGAGAGAGG + Intronic
920185101 1:204154589-204154611 CTGAGGGACTAGAGGGAGCTTGG + Intergenic
920251433 1:204624772-204624794 CTGAGGGTCCAGAGGGAGGGTGG + Intronic
920451899 1:206065680-206065702 CTGTGGGACAACAGGGATCAGGG + Intronic
921032199 1:211343761-211343783 CTGTGAGGCCACAGTGAGAAAGG - Intronic
921199544 1:212792001-212792023 ATACGGGACCAGAGGGAGCAGGG + Intronic
921546146 1:216477270-216477292 CTGTGGTACCTGAGGAAGAATGG - Intergenic
921619523 1:217310652-217310674 CTGTGGGATCAGAGGTGGAAAGG - Intergenic
921804439 1:219437696-219437718 CTTTGGGACCAGGGAGAGAAGGG - Intergenic
922671635 1:227512512-227512534 CTCTGGAACCAGATGGAGGAAGG - Intergenic
922885684 1:229018811-229018833 CTGTGGTTGCAAAGGGAGAATGG + Intergenic
924198554 1:241637043-241637065 CTGTGTGGCCAGAGGTAGAAAGG + Intronic
924244075 1:242064459-242064481 CTCTGGAACCAGATGGAGGAAGG - Intergenic
1062940925 10:1420969-1420991 CTGTGAGAGCAGAGAGAGGAAGG - Intronic
1063095625 10:2906224-2906246 CTGTGGCAGCAGGGGGAGAAAGG - Intergenic
1064965099 10:21007198-21007220 CTGTGGGGAGAGAGGGTGAATGG - Intronic
1065272644 10:24051080-24051102 CTTTGGGAACTCAGGGAGAAGGG - Intronic
1066407739 10:35135073-35135095 CTGTTGCACCACAGGGTGAATGG + Intronic
1066642575 10:37571077-37571099 CTGGGGACCCAGAGGGAGACAGG - Intergenic
1067337934 10:45379432-45379454 CTGTGAGGACAGAGGGAGAGTGG - Intronic
1068137648 10:52965970-52965992 CTCTGGGTCCAGAGGGAGCCAGG - Intergenic
1068566072 10:58577020-58577042 CTGTCGGGCCAGAGGCAGAGGGG + Intronic
1069858722 10:71456890-71456912 CTTTGGGGCCAGAGGGCGATAGG - Intronic
1070070889 10:73088302-73088324 ATGTGGGACAAAAGGGAGAGAGG - Intronic
1070442280 10:76458530-76458552 CAGTGGTACCTGAGGGTGAATGG + Intronic
1070653025 10:78251898-78251920 CTGTGAGGCCACAGTGAGAAGGG - Intergenic
1070794733 10:79210042-79210064 CTGGGGGGGCGGAGGGAGAAGGG - Intronic
1070887709 10:79920068-79920090 CTCTGGGACCTCAGGGAGAATGG + Intergenic
1071599499 10:86951199-86951221 CCTTGGGACCAGAGGGAGCTGGG + Intronic
1073510548 10:104039991-104040013 CTGGGGGACCTGAGGGAAAAAGG + Exonic
1074941215 10:118237326-118237348 CTGGGGGACCAGAGGCTGGAAGG - Intergenic
1075909032 10:126107629-126107651 CTGTGGGGACAGTGTGAGAAGGG - Intronic
1076236943 10:128870947-128870969 CTGAGGGACCACTGGGAGGAAGG - Intergenic
1076258695 10:129048951-129048973 CTCTGGAACCAAAGGAAGAAGGG + Intergenic
1076630418 10:131848946-131848968 CTCTGGCACCAGATGGGGAAGGG - Intergenic
1076848605 10:133082135-133082157 CTGTGGGGCCTCGGGGAGAACGG + Intronic
1076930527 10:133528923-133528945 CTGCGGGCCCAGAGGCGGAACGG - Intronic
1076988510 11:256869-256891 CTGTGAGGCCAGAGGAAGAAGGG + Intergenic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077474851 11:2781515-2781537 CAGTGGGGCCAGAGGGGGAGTGG - Intronic
1078048564 11:7940897-7940919 CTGTGGGACAAGAGGAAGCCAGG + Intergenic
1078093589 11:8282979-8283001 CTGTGGCAGCGGAAGGAGAAAGG - Intergenic
1078841299 11:15077486-15077508 CTATGGGATAAGAGGGGGAAGGG + Intronic
1080484479 11:32691067-32691089 CTGGGGGACAAGAGTGAGACTGG - Intronic
1080497493 11:32834094-32834116 CTTGGGGACCAGACAGAGAAGGG + Intronic
1081224480 11:40503123-40503145 CTGTGTGTTTAGAGGGAGAAAGG - Intronic
1082273094 11:50193179-50193201 CTGAAGGATCAGAGGAAGAAAGG + Intergenic
1083592234 11:63902581-63902603 CTGCTGGGCCAGAGGGAGGATGG - Exonic
1083857282 11:65399528-65399550 GTGTGCGACCGGAGGGAGAAGGG - Intronic
1083975824 11:66119071-66119093 CAGTGGCACCAGATGGACAAGGG + Intronic
1084479497 11:69410499-69410521 CTGTGGGATCAGAGGAGGAAGGG + Intergenic
1084518622 11:69649696-69649718 CTGTGGGGCCAGAGGAATGAAGG + Intronic
1084691892 11:70732420-70732442 CTTTGGGGCCAGGTGGAGAAAGG - Intronic
1084747651 11:71183596-71183618 CCATGGGAGCAGAGGGAGAGTGG - Intronic
1085040810 11:73325241-73325263 CTAGGGGCCCAGAGGGAGACAGG - Intronic
1085656284 11:78318220-78318242 CTGGTGGAACAGAGGCAGAAGGG + Intronic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1087328850 11:96754721-96754743 CTGTGGTACCAGAAAGAGATGGG - Intergenic
1089539739 11:119182568-119182590 CAGTGGGACCAGAGACAGTAGGG - Intronic
1089665769 11:120017680-120017702 CCTTGGGACCAGAGAGGGAATGG + Intergenic
1089768148 11:120783472-120783494 GAGAGGGAGCAGAGGGAGAAAGG - Intronic
1090088253 11:123670403-123670425 CTTCTGGACCAGAGGGAAAAGGG + Intergenic
1090208672 11:124899936-124899958 CTGTGGGGCCAGAGTGATGAAGG + Intergenic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090309359 11:125721155-125721177 CTGTGGGAGCACAGGGAGAGAGG - Intergenic
1090803644 11:130189539-130189561 CTGTGAGAGCAGAGGGCAAAGGG + Intronic
1090887897 11:130895310-130895332 CTGGGGGACCAGAAGCAAAATGG - Intronic
1091095408 11:132816819-132816841 CAGTTGTACAAGAGGGAGAAGGG + Intronic
1092059484 12:5536802-5536824 ATGTGAGAACAGAGGGAAAATGG + Intronic
1092899431 12:13044600-13044622 CTGTGCCACCAGAGGGCGAGAGG + Intronic
1092995164 12:13942949-13942971 CTGAGGGACCAGAGGGGTCAAGG - Intronic
1093625565 12:21343097-21343119 CTGTGGCACCAGATGTGGAAAGG + Intronic
1094032745 12:26031719-26031741 CTGCGGGATCAGAGTGGGAATGG + Intronic
1094050483 12:26215239-26215261 TTGTGGGAATAGAGGAAGAATGG - Intronic
1094952308 12:35947834-35947856 CTTTGAGACCAAAGGTAGAAAGG + Intergenic
1094958188 12:36042608-36042630 CTTTGAGACCAAAGGTAGAAAGG + Intergenic
1095020992 12:37058501-37058523 CTTTGAGACCAAAGGTAGAAAGG + Intergenic
1095024370 12:37113183-37113205 CTTTGAGACCAAAGGTAGAAAGG + Intergenic
1096188318 12:49598632-49598654 CTGCGGGACCAGGGGCAGAAGGG - Intronic
1096238454 12:49945560-49945582 CTTTGGGGACTGAGGGAGAAGGG - Intergenic
1096390998 12:51229006-51229028 CTGAGGGACCAGAGAGAGGCAGG - Intergenic
1096522263 12:52191164-52191186 CTGTGGGACCAGAGGCTTGAGGG + Intronic
1096786617 12:54020428-54020450 CTGTCAGACCAGGGTGAGAAAGG - Intronic
1096805150 12:54136053-54136075 GTGGGGGACAAGAGGGAGAGTGG + Intergenic
1096841181 12:54379868-54379890 CTGGGGGACCAGAGGCTGTAGGG + Intronic
1097174114 12:57133042-57133064 TTGTGGGCTAAGAGGGAGAAAGG + Intronic
1097250485 12:57629984-57630006 CAGCAGGGCCAGAGGGAGAAAGG - Intronic
1097534384 12:60847979-60848001 CTGTGGGACTTCAGGGACAAGGG + Intergenic
1100067604 12:90668769-90668791 CTGTGGGAACACAGGTAGATAGG - Intergenic
1100593236 12:96049100-96049122 CTTTGGGAACAGAGTGAGAAAGG - Intergenic
1100607829 12:96166198-96166220 CTATGTAACCAGAGGCAGAAAGG - Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1100961425 12:99966958-99966980 CTCTGGGATCAGAGGAAGATTGG + Intronic
1102455884 12:113070514-113070536 CTGAGGGACCAGCAGGAGGAAGG + Intronic
1102474725 12:113181098-113181120 CAGTGGGACCACAGGGGGCAGGG + Intronic
1102748983 12:115275670-115275692 CTTTGGGAACTCAGGGAGAAGGG + Intergenic
1102957007 12:117065291-117065313 CTGGGGGAGCAGAGGAAGAAGGG + Intronic
1104437189 12:128765723-128765745 CTGTGGGAGCAGAGTGGGAAAGG - Intergenic
1106176745 13:27338231-27338253 TAGTGGGACCAGAGTGAGTAGGG - Intergenic
1106384962 13:29275496-29275518 GGGTGGGAGCAGAGGGAGTAGGG - Intronic
1107761882 13:43688250-43688272 CTGTGGTGCCATATGGAGAATGG + Intronic
1108559546 13:51628570-51628592 CTGTGAGGCCAGTGGGAGCAAGG - Intronic
1108601717 13:52000632-52000654 CTGTGGGAGCAGCAGGGGAAGGG - Intronic
1108977252 13:56462888-56462910 CTGTAGGTCCAGAGGGAGTCAGG + Intergenic
1109319510 13:60792614-60792636 CTGTGGGACCAGAGTGAAATGGG - Intergenic
1111132906 13:83999586-83999608 CTGGGGTACATGAGGGAGAAAGG - Intergenic
1112742533 13:102491502-102491524 CTGTGGGCACTCAGGGAGAAAGG + Intergenic
1113399707 13:109979564-109979586 CTGTGGGTCCTGGGGGAGCATGG + Intergenic
1115100081 14:29688176-29688198 CAGAGGGACCATAGGGTGAAAGG - Intronic
1115424304 14:33238387-33238409 CTGTGGGACTACAGAGAGAATGG - Intronic
1117908398 14:60613490-60613512 CTGTGGGCCCAGAGGGTCCAGGG + Intergenic
1118438558 14:65792694-65792716 TTGGCTGACCAGAGGGAGAAGGG + Intergenic
1119513275 14:75228350-75228372 CTGTGGGAACAAAGGGAAAAAGG - Intergenic
1119799126 14:77427041-77427063 CTGGGGCAGCAGAGGGAAAATGG + Exonic
1119878259 14:78078585-78078607 CTGTGGGACCACAGAGACTATGG - Intergenic
1121627077 14:95393686-95393708 CTGGGGCTCCAGAGGGATAAGGG - Intergenic
1121939827 14:98059478-98059500 CTGTGAGAGGAGAGAGAGAAAGG + Intergenic
1121943784 14:98098888-98098910 CTGGGGCAGCAGAGGGAGAGGGG + Intergenic
1122082982 14:99279817-99279839 CTTAGGGATCAGAGGGAGCATGG - Intergenic
1122147277 14:99699115-99699137 CTCTGAAACCAGAGTGAGAAGGG - Intronic
1124367321 15:29081292-29081314 CTGTGGGACCAGAGGGGATGTGG + Intronic
1125065430 15:35479199-35479221 CTGTGTGACCAGAGGAAAACTGG + Intronic
1125364609 15:38900571-38900593 ATGTGGAATCTGAGGGAGAAAGG + Intergenic
1126369742 15:47933241-47933263 CTGTGGGAAGAGAGTGAGTAAGG - Intergenic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1128331347 15:66757590-66757612 CTGTGGGACAAGGGCCAGAAGGG - Intronic
1128349543 15:66879891-66879913 CTGGGGAGCCAGAGGGAGATGGG - Intergenic
1129174826 15:73832463-73832485 CTTTGGGAGCAGAGGGAATATGG - Intergenic
1129243986 15:74268815-74268837 CTGTGGGCTCAGGGGGAGCACGG - Intronic
1129445764 15:75616758-75616780 CTGTGGTACCATAGGGAAAGAGG - Intronic
1129608184 15:77034975-77034997 CCGTGGGCCCACAGGGAGGAGGG + Intronic
1129716522 15:77854901-77854923 CAGTGGGACCACAGAGATAAAGG - Intergenic
1129968538 15:79757813-79757835 CTGGGGGACCAGAGGCAGCACGG + Intergenic
1130531584 15:84750808-84750830 CTGTGGGGCTGGAGGGGGAAAGG + Intronic
1130919933 15:88335445-88335467 CTGTGGGAACTCAGGGAGCAGGG + Intergenic
1132116012 15:99137053-99137075 CTGTGGGACCAGGGGAGGGAGGG + Exonic
1132245787 15:100295239-100295261 CTGGGAGACAAGAGGCAGAATGG - Intronic
1133038817 16:3049130-3049152 CTCTGGGTCCTGATGGAGAATGG + Intronic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133888109 16:9850923-9850945 GTGTGGGAGCAGGAGGAGAAGGG - Intronic
1133921133 16:10154192-10154214 TTGTGGGCCCAGATGGAGCATGG - Intronic
1135187699 16:20329437-20329459 AAATGGGAGCAGAGGGAGAAAGG - Intergenic
1136145602 16:28314676-28314698 GTCTGGGATTAGAGGGAGAAGGG + Intronic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137500939 16:49011187-49011209 CTGTGTGGCCACAGGGAGAAAGG + Intergenic
1138967307 16:62100247-62100269 TTGTGATATCAGAGGGAGAAAGG - Intergenic
1138982164 16:62282413-62282435 CTGTGAGACTAGAGAGTGAATGG + Intergenic
1139558478 16:67727497-67727519 CCGTGGCTCCAGAGGGAGACAGG + Intronic
1139890774 16:70252027-70252049 CTGGAGGCCCGGAGGGAGAACGG + Intergenic
1139999225 16:71009867-71009889 CGGAGGGAGCAGAGGGAGAGTGG + Intronic
1140808175 16:78552783-78552805 CAGAGAGAACAGAGGGAGAAAGG - Intronic
1140829411 16:78737592-78737614 CTTTGGGAACTCAGGGAGAAGGG - Intronic
1141892579 16:86936406-86936428 ATATGGGACCAGAGGGAGGGAGG + Intergenic
1143682021 17:8482586-8482608 CTGAGGGACCCACGGGAGAAAGG + Intronic
1143684681 17:8504347-8504369 AGATAGGACCAGAGGGAGAAGGG - Intronic
1144887930 17:18476696-18476718 AAGTGGGTCCAGAGAGAGAAAGG - Intergenic
1145144278 17:20467605-20467627 AAGTGGGTCCAGAGAGAGAAAGG + Intergenic
1145175729 17:20699005-20699027 AAGTGGGTCCAGAGAGAGAAAGG + Intergenic
1145791585 17:27631107-27631129 AAGTGGGTCCAGAGAGAGAAAGG - Exonic
1145883106 17:28365776-28365798 TTGAGGGGCCAGAGAGAGAAAGG - Intronic
1146618857 17:34380456-34380478 TTTTGGGACAAGAGGGAAAAGGG - Intergenic
1147794058 17:43030218-43030240 CAGTGGGACCAGAGCCAGGAAGG - Intergenic
1148642828 17:49201123-49201145 CTGTGGGAAATGAGGGAGAAGGG + Intergenic
1149597393 17:57872442-57872464 CTCTGAGTCCCGAGGGAGAAAGG + Intronic
1151147247 17:72052839-72052861 ATGAGGTACCAGAGGGATAATGG + Intergenic
1151353782 17:73546554-73546576 CTGGCTGACCAGAGGGAGCAAGG + Intronic
1151572450 17:74933646-74933668 CTCTGGGACCAGAAGGAAATGGG - Exonic
1151871650 17:76840832-76840854 CTGAGGGAACAGAGGGAGTCAGG - Intergenic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1154027340 18:10720995-10721017 ATGTGGGACCTGAGGGAGAAAGG - Intronic
1155238093 18:23841567-23841589 GTGTGGGACAAAAGGGACAAGGG + Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1157446106 18:47748024-47748046 CTGTGGGTCCATAGGGAAATGGG - Intergenic
1157615880 18:48987439-48987461 ATCTGGGAGCAGAAGGAGAAAGG - Intergenic
1158523170 18:58188617-58188639 CTGTGGGACCAGAGCAACACAGG - Intronic
1158550405 18:58430999-58431021 CTGTGGGACCTTGGGGACAAAGG - Intergenic
1159027134 18:63194031-63194053 CTGTGGGAGCAGAGAGCTAAAGG - Intronic
1159122512 18:64187248-64187270 CTGTGGAAACTCAGGGAGAATGG + Intergenic
1160297880 18:77654580-77654602 CTGTGTGATGAGAGGGAGAGCGG - Intergenic
1160893817 19:1393526-1393548 CAGAGGGATCAGAGGGAGCAGGG + Intronic
1161271740 19:3393321-3393343 CTGCCGGAGGAGAGGGAGAAGGG + Intronic
1162777239 19:12987340-12987362 CTGTGGGAACAGAGGAGGAGAGG + Intergenic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164536172 19:29087898-29087920 CTGTGGGGCCAGGGGGAACAAGG + Intergenic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1164840844 19:31391075-31391097 ATATGGGAGGAGAGGGAGAAAGG + Intergenic
1166257824 19:41618937-41618959 CTGTGTGACCCGGGAGAGAATGG + Intronic
1166349031 19:42185609-42185631 CAGGGGGACAAGAGTGAGAAGGG - Intronic
1166979629 19:46624923-46624945 GTGTGGGGTTAGAGGGAGAAAGG - Intronic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167668946 19:50838837-50838859 CTGGGGGATCTGAGGGAGGAGGG + Intergenic
1167799457 19:51730604-51730626 CTCTGGGGTCTGAGGGAGAAGGG + Intergenic
1168325317 19:55536011-55536033 CTGTGGGGCCAGAGGTGGCAGGG - Intronic
925436544 2:3843106-3843128 CTGTGATAGCAGGGGGAGAAGGG + Intronic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
925844170 2:8020591-8020613 CTGTGGGACCAGAGGAGAACTGG + Intergenic
926135038 2:10330571-10330593 GTGTGAGAACAGAGGGAGAAAGG - Intronic
926709442 2:15866014-15866036 CTTTGGGACCAGATGGTGAGTGG + Intergenic
927604793 2:24477127-24477149 CTGTAGGAGCAGAGTTAGAAAGG - Intergenic
928395937 2:30943373-30943395 CAGTGGATCCAGAGGGTGAAGGG + Intronic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
928673661 2:33628524-33628546 TTGTTGTAGCAGAGGGAGAATGG - Intergenic
930033671 2:47072786-47072808 TTGTGGGACCTGAGGCTGAAAGG + Intronic
930234235 2:48873663-48873685 CTCTGGGAGCAGAGGGAGCAGGG + Intergenic
930415844 2:51090347-51090369 CTGTTGGGACATAGGGAGAAAGG - Intergenic
931249143 2:60514990-60515012 CTGTCTCACCAGAGGGAGAACGG - Intronic
931457614 2:62424571-62424593 CTGTGTGACAAGATGGAGAAGGG + Intergenic
932582982 2:73004628-73004650 CTGGGAGACCAGAGGGAGTGTGG + Intronic
932759102 2:74427986-74428008 CTGAGGGAGAAGAGGGAGAGAGG + Intronic
933769285 2:85733069-85733091 CTCTGAGCCCAGAGGGAGCAGGG - Intergenic
934014478 2:87864461-87864483 CTGGGGGACCAGAAAGAGAGTGG - Intergenic
934685104 2:96315425-96315447 CTGTGGGACTTGAGAGAGCAAGG + Intergenic
935276239 2:101477284-101477306 CTGTAGGACCAGTATGAGAAGGG - Intergenic
935305434 2:101732321-101732343 GGGTGGGGCCAAAGGGAGAATGG + Intronic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
936287118 2:111189400-111189422 CTGTGGGACCCAAGGCAGGAGGG - Intergenic
937998828 2:127715890-127715912 CCCAGGGACCAAAGGGAGAAGGG - Intronic
938247625 2:129791316-129791338 CTGTGGGACCAGAGGTGGACTGG - Intergenic
938444389 2:131366425-131366447 CTGGGGGAGCAGGGAGAGAATGG - Intergenic
939480506 2:142741829-142741851 CTATGGGATCTGGGGGAGAAGGG + Intergenic
939994324 2:148906125-148906147 CCTTGGGGCCAGAGGGAAAAAGG + Intronic
941320287 2:164046315-164046337 CCATGGGATTAGAGGGAGAAAGG + Intergenic
942999754 2:182311511-182311533 CTGTAGGACCAGAAGTAGGAAGG - Intronic
943169830 2:184384656-184384678 ATGTGAGAACAGATGGAGAACGG - Intergenic
943731381 2:191306689-191306711 AAGGGGGATCAGAGGGAGAAAGG + Intronic
944032383 2:195251144-195251166 CTGTGGAATTAGAGAGAGAAAGG + Intergenic
945282874 2:208052867-208052889 GGGTGGGACTAGAGGGAAAATGG - Intergenic
946161607 2:217839191-217839213 CCGTGTGGCCAGAGGAAGAAAGG + Intronic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946424509 2:219586018-219586040 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
946434416 2:219642321-219642343 CTGTGGGGCCACAGAGGGAATGG + Intergenic
946434805 2:219644404-219644426 CTGTGGGGCCACAGAGGGAATGG + Intergenic
946715529 2:222551287-222551309 ATGTGAGGCCAGAGGGAAAACGG - Intronic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
947544275 2:231000343-231000365 CTGTGGGGACAGAAGGAGAGAGG - Intronic
947592835 2:231395301-231395323 CTTTGGGGCCAGAGGCAGACAGG - Intergenic
1169482841 20:6000967-6000989 CTGCAGGACCAGAGGGAAACAGG + Intergenic
1171091606 20:22290684-22290706 CTGAAGGACCAGAGAGAGATAGG + Intergenic
1173078831 20:39846672-39846694 CATTGGGAGCAGAGGGAGAAAGG - Intergenic
1173322550 20:42001380-42001402 CTCTGTGTCGAGAGGGAGAATGG + Intergenic
1173670168 20:44793434-44793456 ATATGGGAGCAGAGGGAGAAAGG - Intronic
1175121729 20:56721193-56721215 GTGTGGGGCCAGGGAGAGAAGGG + Intergenic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1175925040 20:62467341-62467363 TTGTGCGGCCAGTGGGAGAAAGG - Intronic
1176221732 20:63972531-63972553 CTGTGTGACCCGAGGAGGAAGGG + Intronic
1176427015 21:6554230-6554252 CTGTGAAACCAGAGCGAAAACGG - Intergenic
1177055924 21:16300806-16300828 GTGAGGGACCAAAGGCAGAAAGG - Intergenic
1178124804 21:29504949-29504971 TTGTGGGGCCAGAGAGAGAAGGG + Intronic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1178436779 21:32567099-32567121 CTGTGGTACAAGGGGGAGAGAGG + Intergenic
1178619598 21:34161989-34162011 CTGGGGTACTTGAGGGAGAAGGG + Intergenic
1178785404 21:35648842-35648864 AAGTGAGATCAGAGGGAGAATGG - Intronic
1178822007 21:35983866-35983888 CTGTGGGACTTGAGGGGCAAGGG + Intronic
1178947253 21:36958995-36959017 CTGTGGAACCAGGGGGAGCTGGG + Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179702506 21:43162552-43162574 CTGTGAAACCAGAGCGAAAACGG - Intergenic
1180862111 22:19089491-19089513 CTGTGGGACCAAAGGGTGAGAGG + Intronic
1180907139 22:19422401-19422423 GTGGGGGACCAGAGGGAGGGAGG - Intronic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1181975564 22:26726903-26726925 CTGAGGGAGTAGAGGGACAAAGG + Intergenic
1182358940 22:29735384-29735406 CTGGGTGGCCAGAGGGACAATGG + Intronic
1182367628 22:29789499-29789521 ATGTGGCCCCAGAGGGAGAAAGG - Intronic
1183043272 22:35199535-35199557 CTGTGGCAACAGGGAGAGAAAGG - Intergenic
1183163798 22:36132478-36132500 CCGTGGGAGCAGTGGGGGAAAGG - Intergenic
1183485382 22:38085376-38085398 CTGTAGGAGGAGAGAGAGAATGG + Intronic
1183500221 22:38174442-38174464 GAGTGGGAACAGAGGGAGATTGG + Intronic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184996510 22:48211028-48211050 CTGTGGGAGCAAGAGGAGAAGGG + Intergenic
950083237 3:10238725-10238747 CTTTGGGAGAAGAGAGAGAAGGG - Intronic
950658493 3:14452134-14452156 CTGTGAAAACAGAGGGAGGAAGG - Intronic
950789493 3:15461262-15461284 CTGTGGGACCAGATGGTGCTGGG - Intronic
951430002 3:22595791-22595813 GTGTGGGACAGGAGAGAGAAAGG + Intergenic
951772293 3:26272013-26272035 CTGAGGGACCAGAGACAGAAAGG - Intergenic
952255104 3:31688205-31688227 GTGTGAGACCAGAGGGAGGTGGG - Intronic
952769353 3:36983778-36983800 TTATGGGAGCAGAGGGTGAAGGG - Intergenic
952959390 3:38580094-38580116 CTCTGGGACCACAGGGAGGCAGG + Intronic
952967538 3:38630544-38630566 CTGAGGGAGGAGAGGGGGAAGGG + Intronic
953375484 3:42424647-42424669 AGGTGGGGGCAGAGGGAGAAGGG + Intergenic
953872804 3:46642132-46642154 CTGTGGGACAAAAGAGAGAAGGG + Intergenic
953925570 3:46980770-46980792 CTGTGGGTACAGAAGGAAAATGG - Intronic
954089692 3:48274376-48274398 CTGTAGAACCAGTGAGAGAAGGG + Intronic
954301094 3:49701227-49701249 CTGTGGGACAAGCTGGAGAGAGG - Intronic
954334747 3:49909723-49909745 CTGTGGGCCAAAAGGGACAAAGG + Intronic
954366724 3:50150390-50150412 ATGTGAGTCCAGAGCGAGAAAGG - Intergenic
955136811 3:56227143-56227165 CTATGGGACAAGAGGAGGAAAGG - Intronic
955911416 3:63863408-63863430 GGGTGGGACCAGAGGGAGTCCGG - Intronic
956642923 3:71431588-71431610 GTGTGGGACCAGATGGACCAGGG - Intronic
957938276 3:86971382-86971404 CTGTGTGACCACAGGATGAATGG - Intronic
959495551 3:107046979-107047001 CTGTGGGACCACATTGAGCAAGG + Intergenic
960729491 3:120710535-120710557 ATGTGGGCACAGATGGAGAAAGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961810364 3:129518534-129518556 CTGTGGCACCTGAGGGAGCCTGG - Intronic
962279014 3:134036318-134036340 CTGAGGGACCAGACAGGGAAGGG - Intronic
962832731 3:139158573-139158595 CTGGGGGCACAGGGGGAGAAGGG + Intronic
963538364 3:146556404-146556426 CTCTGGGAACACAGGGAGAGAGG - Intergenic
965071416 3:163920053-163920075 CAGAGGGACCAGAGGGGTAAAGG - Intergenic
965637473 3:170798273-170798295 CTGGGGGTTGAGAGGGAGAAGGG + Intronic
966405292 3:179591283-179591305 CTGTGGCTCCAGAGAGAGACAGG - Intronic
968641081 4:1715371-1715393 CTGTGGGTCAAGAAGCAGAATGG + Intergenic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
969328757 4:6460830-6460852 TTGTGGAACCAGATGGAGATGGG - Intronic
969707390 4:8819227-8819249 CTGTAGCCCAAGAGGGAGAAGGG + Intergenic
969761981 4:9193143-9193165 CTGTGAGAACAGAGAGTGAAGGG + Intergenic
972710747 4:41592074-41592096 CAGTGCTATCAGAGGGAGAAGGG - Intronic
973133390 4:46676142-46676164 CTGTGGGACAAGAGGAGAAATGG - Intergenic
973339531 4:48989665-48989687 CTGTGGGAGGCCAGGGAGAATGG - Intronic
973581611 4:52349550-52349572 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
973774079 4:54229922-54229944 CTGGGGGACCAGGGGGAGGTGGG + Intronic
973831898 4:54769916-54769938 CTCTGGGACTAGATGGAGAGTGG - Intergenic
974117503 4:57598143-57598165 CTATGGGAGCAGAGAGAAAAGGG + Intergenic
975084498 4:70321414-70321436 ATGTGAAACCAGAAGGAGAAAGG - Intergenic
975836182 4:78424329-78424351 CTTTGGGATCAGAGAGAGATAGG - Intronic
978683713 4:111414677-111414699 GTGTGGGACCTGTGGGAGACAGG + Intergenic
980182215 4:129414809-129414831 CTGTGACACCATAGGTAGAAAGG - Intergenic
980738106 4:136917427-136917449 CTGTGGAGCCAGAGGGAGCCAGG + Intergenic
981195904 4:141920110-141920132 CAGTGGGACCACAGGGAGTGGGG - Intergenic
982553337 4:156830448-156830470 CTGTAGGTCCACATGGAGAATGG - Intronic
982964047 4:161879577-161879599 GTGTGGGACAAGAGTGAGGAAGG - Intronic
983323683 4:166227054-166227076 CTGTGGAACCAGTGGGAGCTGGG + Intergenic
984097431 4:175449624-175449646 CAGCTGGACCAGAGGGAGAAAGG + Intergenic
984558609 4:181241969-181241991 CTGTGTGCCCAGAAGGAGAAAGG + Intergenic
984770175 4:183430579-183430601 CTGTGGGACAGCAGAGAGAAGGG + Intergenic
986032443 5:3906749-3906771 CTGTGGGACCAGGAGGAGCCAGG + Intergenic
986736005 5:10667750-10667772 CTGAGGCCCCAGAGGGAGCATGG - Intergenic
988102860 5:26704736-26704758 CAGTGGGACAAGAGGGAGAGGGG + Intergenic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
993508898 5:88746821-88746843 CCTTGGGACCAGAGTTAGAAAGG + Intronic
994158290 5:96527428-96527450 CTTTGAGATCAGAGGGTGAAAGG - Intronic
994636003 5:102344876-102344898 CAGGTGGACTAGAGGGAGAAAGG + Intergenic
994796169 5:104302508-104302530 CTGTGTGAACAGAGGAAGCATGG - Intergenic
997377598 5:133408473-133408495 CTGGTGGAGCAGAGGGAGAAGGG + Intronic
997487940 5:134247697-134247719 ATGAAGGAACAGAGGGAGAAAGG + Intergenic
997737495 5:136224783-136224805 CTGTGGAAGCAGAGGGTGGAGGG - Intronic
998266061 5:140668685-140668707 CTCTGGGACCAGCGGAAGGAGGG + Exonic
998807516 5:145933385-145933407 GGGTGGGAACAGCGGGAGAAGGG + Intergenic
998908991 5:146937500-146937522 CTGTGGGTCCACAGAGAGGAGGG + Intronic
999148550 5:149411896-149411918 CTGTGTGCCCAGAGGGATAATGG - Intergenic
999274303 5:150318822-150318844 CAGTGGGACTGCAGGGAGAAGGG + Intronic
999371334 5:151057018-151057040 ATGAGGAAGCAGAGGGAGAATGG - Intronic
999586230 5:153092688-153092710 CTGTGAGAGCAGAGGGAGCCAGG - Intergenic
1000103598 5:158037974-158037996 CAGTGGCATCAGAGGGAGACCGG + Intergenic
1001092053 5:168748768-168748790 TTGTGGGAGCAGAGAAAGAAAGG - Intronic
1001956408 5:175850930-175850952 CTGAGGAACCAGAGGCAGGAGGG + Intronic
1002018781 5:176348149-176348171 CTGTGGTTTCAGAGGGAGAAGGG - Intronic
1002069106 5:176668312-176668334 CTCTGGGACCACAGGCAGGAAGG - Intergenic
1002451354 5:179320620-179320642 CTGTGCTATCAGAAGGAGAAGGG - Intronic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002839484 6:893749-893771 CTGTGGGGACAGAGGAAGAAAGG - Intergenic
1003369123 6:5507780-5507802 CGGAGGGAGCAGAGGGACAAGGG + Intronic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1003838417 6:10095171-10095193 TGGTGGGCCCAGAGGGAGGAAGG + Intronic
1005281337 6:24277970-24277992 CTGTGGGCCCAGAGAAACAATGG + Intronic
1006741537 6:36312561-36312583 CTGTGAGCCGAGAGAGAGAACGG + Intergenic
1006812198 6:36827224-36827246 GTGTGGGATCAGAGGGTGTAGGG - Intronic
1006945040 6:37779295-37779317 CTGAGAGGCCAGAGGGAAAAGGG + Intergenic
1007107510 6:39293978-39294000 CTGTGGGGACAGTGGCAGAAGGG - Intergenic
1008040952 6:46797615-46797637 CTTTGGGACAAGAGGCAGAATGG + Intronic
1008526518 6:52412786-52412808 CTTGGGGACCATAGTGAGAAAGG - Intergenic
1008627364 6:53330899-53330921 CAGTGGGACAAGATGTAGAAGGG - Intronic
1011344365 6:86352801-86352823 CAGTGGGGCCAAATGGAGAATGG - Intergenic
1012253631 6:97008012-97008034 ATGTGGGACCAGTGGAAGCAGGG + Intronic
1013044398 6:106470058-106470080 CTCGGGGACCAAAGGGAGGAGGG - Intergenic
1013629016 6:111967145-111967167 TTGTGGACCCAGAGGTAGAAAGG + Intergenic
1013912054 6:115287688-115287710 CTGTGGTAGCAGTAGGAGAATGG - Intergenic
1015394320 6:132717889-132717911 CTATGAGACCAGAGGAAAAATGG - Intergenic
1018922353 6:168184116-168184138 CTCTGGGACCAGAAGGAGGAAGG + Intergenic
1021159886 7:17259811-17259833 CTGTGTGCCCTGAGGGAGACAGG - Intergenic
1021788919 7:24180164-24180186 CTGTGTGACTAGAGGAAGACAGG - Intergenic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1022092076 7:27114130-27114152 GGGAGGGACCGGAGGGAGAAGGG + Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1023238217 7:38113661-38113683 CTGTTAGACCAGAGGAAAAAAGG - Intergenic
1023682029 7:42696968-42696990 CTCTGAAACCAGAGGGAGCATGG + Intergenic
1023967026 7:44968044-44968066 CTATGGGAACAGAGGCAGATGGG - Intronic
1024268703 7:47626083-47626105 CAGTGAGAGCAGAGAGAGAAAGG + Intergenic
1025625143 7:63214541-63214563 CTGAAGGATCAGAGGAAGAAAGG + Intergenic
1026901171 7:74038310-74038332 CTGTGGGACCAGGGTCAGCAGGG - Intronic
1026955798 7:74375864-74375886 CTGTGGGGAGAGAGGGAGACAGG - Intronic
1027400163 7:77798689-77798711 CTGTGGGCCCAATGGGAGCACGG - Intergenic
1028341874 7:89732339-89732361 TTGTGAGACCAGAGTCAGAAGGG + Intergenic
1029306287 7:99622402-99622424 GTGTGGTACCAGAGTGAAAAGGG + Intronic
1030187729 7:106779972-106779994 CTGTGGGAAAAGAGGGAGCATGG - Intergenic
1030509588 7:110468320-110468342 GATTGGGACTAGAGGGAGAAGGG - Intergenic
1033662332 7:143410716-143410738 GTGTGGGAGTAGAGGGAGAGAGG - Intergenic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1034337141 7:150330885-150330907 CTGCTGGCCCAGAGGGAGAAGGG + Exonic
1034827771 7:154282190-154282212 CTATGGGGCCACAGAGAGAATGG - Intronic
1035355311 7:158273099-158273121 CTGTGGGACGAAGGGGAGAGAGG + Intronic
1035869124 8:3118026-3118048 TTGTAGGACCAGAGGGAAAAAGG - Intronic
1035979096 8:4348898-4348920 CTGTGATATCACAGGGAGAAAGG - Intronic
1036272083 8:7315009-7315031 CTGTGAGAACAGAGAGTGAAGGG + Intergenic
1036349262 8:7995336-7995358 CTGTGAGAACAGAGAGTGAAGGG - Intergenic
1036684790 8:10902499-10902521 CAGAGGGACCAGACGGAGAAAGG - Intronic
1036844554 8:12155873-12155895 CTGTGAGAACAGAGAGTGAAGGG - Intergenic
1036865924 8:12398206-12398228 CTGTGAGAACAGAGAGTGAAGGG - Intergenic
1037385328 8:18333819-18333841 CTGTAGGACGAGAGAGAGAATGG + Intergenic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1040688904 8:49910726-49910748 GTGGGAGACCAGAGGGAAAATGG + Intronic
1041131073 8:54701001-54701023 CTGGGGAACTAGAGGGAGATGGG + Intergenic
1042420662 8:68584881-68584903 CTGTGGAGCCAGAGGGAGAAGGG - Intronic
1044310864 8:90690525-90690547 CTCAGGGACCAGTGGAAGAAGGG - Intronic
1044662378 8:94604198-94604220 CTGTAGGACAAGATGGGGAAGGG + Intergenic
1045622377 8:103995461-103995483 CAGTGGAGACAGAGGGAGAATGG + Intronic
1045826967 8:106409261-106409283 TTGTGGGGCCAAAGGGAGGATGG + Intronic
1045968745 8:108055992-108056014 CTGAGGGACCAGAGGGTGAATGG - Intronic
1047345424 8:124023421-124023443 CTGTGGGAATAGAGGGAGTTGGG - Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1049038047 8:140091930-140091952 CTGTGGGGCCGGCGGGAGATGGG - Intronic
1049410919 8:142473681-142473703 CTCTGGGACCTGTGGGAGTATGG + Intronic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050001185 9:1078412-1078434 CTGTGGCACTATAGAGAGAAAGG - Intergenic
1050982476 9:12037354-12037376 CTGGAGTACCAGAGGGAGACAGG + Intergenic
1051857175 9:21581856-21581878 CTGAGGGAACAAAAGGAGAAAGG - Intergenic
1052635189 9:31093932-31093954 CTTTGATACCAGAGGGAGAAAGG - Intergenic
1052712129 9:32069812-32069834 CTGTGTTACCAGAGGTGGAAAGG - Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1056497255 9:87170506-87170528 CTGTTGGTCAAGAGGCAGAAAGG + Intergenic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058775495 9:108279659-108279681 TTGGGAGATCAGAGGGAGAAGGG + Intergenic
1058926284 9:109667155-109667177 CTCTGGAATCAGAGGGAGAGTGG + Intronic
1058927767 9:109684400-109684422 CTCAGTGACCACAGGGAGAAGGG + Intronic
1059217203 9:112575148-112575170 CTGTGTTAACTGAGGGAGAAAGG - Exonic
1059445783 9:114337026-114337048 CTGGGGGCCCAGAGGCAGATGGG - Exonic
1059542310 9:115143113-115143135 CTGTGTGAACACAGGGAAAAAGG + Intronic
1059658411 9:116377553-116377575 CTGTGGGAAGAGGGAGAGAAAGG - Intronic
1060209047 9:121699295-121699317 CGGGGGGACAAGAGGGGGAAGGG - Intronic
1060434387 9:123581148-123581170 CTGTGGGTCAAGCGGGAGTAAGG + Intronic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060987329 9:127827187-127827209 CTATGGGAAGACAGGGAGAAAGG + Intronic
1061002382 9:127909847-127909869 CTGTGGGGGCAGAGGGAGTGTGG - Intronic
1061091310 9:128428152-128428174 CTGTGGGACCAGAGGGAGAAAGG - Intronic
1061272606 9:129551854-129551876 CTGTGGGAACAGAGTGGGCAAGG - Intergenic
1061868489 9:133507521-133507543 CTGGGAGACCCGAAGGAGAAGGG - Intergenic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062315427 9:135964845-135964867 CTGTGGCTCCAGAGGGAGCGTGG - Intergenic
1186777989 X:12884561-12884583 CACTGGGACCCTAGGGAGAAAGG - Intronic
1188838720 X:34989249-34989271 CAGATGGACTAGAGGGAGAAAGG + Intergenic
1189054127 X:37680692-37680714 CTGAGGAAGAAGAGGGAGAAGGG + Intronic
1190341933 X:49303853-49303875 CTGTGGCCTCTGAGGGAGAAGGG + Intronic
1190344161 X:49322235-49322257 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190345256 X:49331780-49331802 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190346350 X:49341346-49341368 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190347601 X:49532375-49532397 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190348702 X:49541931-49541953 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190349802 X:49551487-49551509 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190350907 X:49561040-49561062 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190352008 X:49570598-49570620 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190353109 X:49580147-49580169 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190354210 X:49589694-49589716 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190355312 X:49599218-49599240 CTGTGGCCTCCGAGGGAGAAGGG + Intronic
1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG + Intergenic
1190632677 X:52402956-52402978 TTGTGGGAACACAGAGAGAAGGG - Intergenic
1191116436 X:56857839-56857861 CTGTGGCTTCAGAGGGTGAAAGG - Intergenic
1192039669 X:67605245-67605267 CTCAGGGACCAGTGTGAGAATGG + Intronic
1192173692 X:68873046-68873068 CTGAGGCCCCAGAGGGAGAAAGG - Intergenic
1192193777 X:69015357-69015379 CTGTGGAACACCAGGGAGAAGGG + Intergenic
1192201341 X:69068575-69068597 CTGTGGGCCCTGAAGGAAAAAGG - Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194566201 X:95492464-95492486 CTCAGGAACCTGAGGGAGAAAGG - Intergenic
1195466691 X:105187038-105187060 CTGTGGTAGCAGAGGTACAAAGG - Intronic
1196117861 X:112016549-112016571 ATGTGGGACCAGGAAGAGAAAGG - Intronic
1198384367 X:136114550-136114572 CTGTGGAACAAGAGAGAGAGTGG - Intergenic
1199129999 X:144174011-144174033 CTGGGGGACCAGAAAGAGAGTGG + Intergenic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1201235710 Y:11908902-11908924 CTGTGGGCCCTGGAGGAGAAAGG + Intergenic