ID: 1061092296

View in Genome Browser
Species Human (GRCh38)
Location 9:128433518-128433540
Sequence ATGGCTCCTGGTCTTGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061092283_1061092296 27 Left 1061092283 9:128433468-128433490 CCACCATCTGTCATGCTTGCACT 0: 1
1: 0
2: 1
3: 15
4: 214
Right 1061092296 9:128433518-128433540 ATGGCTCCTGGTCTTGGCCATGG No data
1061092284_1061092296 24 Left 1061092284 9:128433471-128433493 CCATCTGTCATGCTTGCACTCAG 0: 1
1: 0
2: 0
3: 18
4: 181
Right 1061092296 9:128433518-128433540 ATGGCTCCTGGTCTTGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061092296 Original CRISPR ATGGCTCCTGGTCTTGGCCA TGG Intronic
No off target data available for this crispr