ID: 1061092414

View in Genome Browser
Species Human (GRCh38)
Location 9:128434086-128434108
Sequence CAACCACCTGTGGCATACAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 91}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061092414_1061092423 1 Left 1061092414 9:128434086-128434108 CCATTGTATGCCACAGGTGGTTG 0: 1
1: 0
2: 0
3: 15
4: 91
Right 1061092423 9:128434110-128434132 CAGGGGCCTGGCCCGGGTCCTGG 0: 1
1: 1
2: 7
3: 67
4: 752
1061092414_1061092421 -5 Left 1061092414 9:128434086-128434108 CCATTGTATGCCACAGGTGGTTG 0: 1
1: 0
2: 0
3: 15
4: 91
Right 1061092421 9:128434104-128434126 GGTTGCCAGGGGCCTGGCCCGGG 0: 1
1: 1
2: 3
3: 64
4: 655
1061092414_1061092420 -6 Left 1061092414 9:128434086-128434108 CCATTGTATGCCACAGGTGGTTG 0: 1
1: 0
2: 0
3: 15
4: 91
Right 1061092420 9:128434103-128434125 TGGTTGCCAGGGGCCTGGCCCGG 0: 1
1: 0
2: 10
3: 76
4: 780
1061092414_1061092425 10 Left 1061092414 9:128434086-128434108 CCATTGTATGCCACAGGTGGTTG 0: 1
1: 0
2: 0
3: 15
4: 91
Right 1061092425 9:128434119-128434141 GGCCCGGGTCCTGGTGTTTGAGG 0: 1
1: 0
2: 3
3: 14
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061092414 Original CRISPR CAACCACCTGTGGCATACAA TGG (reversed) Exonic
901245648 1:7728423-7728445 CAACATCCGGTGGCAGACAAAGG - Intronic
906929724 1:50157243-50157265 CAACAACCTGAGGCACAGAATGG - Intronic
906987715 1:50703787-50703809 CAGCCAACTGTGGCACACAATGG + Intronic
907742879 1:57184223-57184245 GAAACACCTGTGGTACACAAAGG - Intronic
912642013 1:111355588-111355610 CAACTACCTGTGTGATTCAAAGG - Intergenic
913069825 1:115288615-115288637 CAAACTGCTGTGGAATACAAGGG - Intronic
916346417 1:163796840-163796862 GAAACACCTGTGGCATGCAATGG + Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
917964503 1:180169847-180169869 CAAACTCCTGTGGCATACCCTGG - Intronic
919704522 1:200663699-200663721 CAACAGCCTTTGGCATATAATGG + Intronic
920118405 1:203637464-203637486 CAACCACTTTTGACCTACAAAGG + Intronic
921294492 1:213689205-213689227 CAGCCACCTGTGCCAGGCAAGGG - Intergenic
924194731 1:241594192-241594214 AAACCACTTGTGGCACACGATGG - Exonic
924725164 1:246662862-246662884 CAGCCACCTGTGGCTCACATCGG + Intronic
1063330414 10:5153193-5153215 AAACAACGTGTGGCATACAATGG + Intergenic
1065344240 10:24733765-24733787 AAACCACCTATGGAAGACAATGG - Intergenic
1066533985 10:36370423-36370445 CATCCACCTGTGGCAGAAAGGGG - Intergenic
1067427834 10:46222955-46222977 CAAGCACCTGTGCAATACCAAGG + Intergenic
1067583254 10:47458840-47458862 CAAGCACCTGTGCAATACCAAGG + Intergenic
1071337473 10:84612481-84612503 CAACCCCCTGCTGCAGACAAGGG - Intergenic
1073578733 10:104644950-104644972 CAACCACCTGGGGCACACACTGG - Intronic
1073604874 10:104884031-104884053 CAGCCACCTGTAGCAAACCAGGG + Intronic
1074926289 10:118075553-118075575 AAACAAAATGTGGCATACAATGG - Intergenic
1078561410 11:12376618-12376640 CAATCAGCTGTGGCCTAGAAGGG + Intergenic
1078862333 11:15260936-15260958 CATCCACCAGTGGCTCACAAAGG + Intergenic
1079762449 11:24346621-24346643 CAACCACTTTTGGCAAACAATGG - Intergenic
1082866266 11:57902544-57902566 CAACCTCCTCTGGGAAACAAAGG + Intergenic
1087969011 11:104455822-104455844 CCACCACCTCTGTCATACATTGG + Intergenic
1090349493 11:126098438-126098460 CAAACAGCTGTGGCCTCCAAAGG + Intergenic
1092188883 12:6503140-6503162 CCACCACGTCTGGCCTACAAAGG + Intronic
1106785155 13:33100058-33100080 CTACCTCCTGTGACAAACAATGG + Intergenic
1107417372 13:40213069-40213091 CAACCATATGTTGCATCCAATGG + Intergenic
1109319245 13:60789725-60789747 CAACCACCTGTCATATAAAAAGG - Intergenic
1111992269 13:95128319-95128341 AAACCTCCTGTGCCACACAATGG + Intronic
1112713807 13:102160396-102160418 AAACCACCTGTGGCAGGAAAGGG + Intronic
1113228884 13:108190692-108190714 CTACAAACTGTGGCATATAAGGG + Intergenic
1120395922 14:83966789-83966811 TAAACACCTGAGGCATAAAAGGG - Intergenic
1125886085 15:43230588-43230610 CAAGCTCCTATGGCAGACAAGGG + Intergenic
1131349332 15:91682796-91682818 CCACCACCTGTGAGATACAAAGG + Intergenic
1134191595 16:12125532-12125554 CAACCACCTGTGAGAAACAGAGG - Intronic
1137572674 16:49577094-49577116 CAACCACCCAGGGCAGACAATGG + Intronic
1139936832 16:70577616-70577638 CAACTACTTGTGGCATGCATTGG + Exonic
1141026360 16:80552368-80552390 CAGACATCTGTTGCATACAAAGG - Intergenic
1141989402 16:87602005-87602027 AAACCACCTGTGGTTTGCAAAGG + Intronic
1143890465 17:10098494-10098516 GACCCACCTTTGGCAAACAAAGG - Intronic
1144446567 17:15335440-15335462 CAATCACCTGGAGCATTCAAGGG + Intronic
1144658019 17:17050519-17050541 CCACCACCTGTGGCACCCCAGGG - Intronic
1144850828 17:18243053-18243075 CCACCACCTGTCACATGCAAGGG - Intronic
1146497332 17:33334779-33334801 CCATCACCTGTGGAATACACAGG - Intronic
1149062295 17:52437121-52437143 AAACCACTTGAAGCATACAAAGG - Intergenic
1155685713 18:28547138-28547160 GAACAACCTGAGGCATACAAAGG + Intergenic
1157790859 18:50529691-50529713 CAAACACCTGTGACAAGCAAGGG - Intergenic
930431139 2:51278013-51278035 CAAGCCCCACTGGCATACAATGG - Intergenic
937430087 2:121831115-121831137 CAATCAACTGTGGTCTACAATGG - Intergenic
943158080 2:184210536-184210558 GAAACAACTGTGGCATACACAGG - Intergenic
944373857 2:199016764-199016786 CAACCATCTGTGCCACTCAAGGG + Intergenic
1170671736 20:18440581-18440603 CAACCACCTGTTGCATTCTAGGG - Intronic
1170996749 20:21368512-21368534 CCACCACCTGTGACTTACCAGGG + Exonic
1173733293 20:45342957-45342979 AAAACACCTGTGGCACTCAAAGG - Intronic
1175627272 20:60500189-60500211 CAACGACCAGTGGCATAGAATGG + Intergenic
1175886419 20:62293769-62293791 GAACCACCTGCCGGATACAAGGG - Exonic
1178311196 21:31531340-31531362 CAGCCACCGGTGCCACACAAGGG + Intronic
1178705713 21:34871174-34871196 AAAACAGCTGTGGCATGCAAGGG - Intronic
1179147954 21:38785197-38785219 TAGCCAACTGAGGCATACAACGG - Intergenic
1180195593 21:46191732-46191754 CCACCAACTGTGGCATTCACTGG + Intronic
1181442357 22:22943237-22943259 CACCCACCTGTCACATACACAGG + Intergenic
1181864988 22:25847704-25847726 CACCCACCAGTGGCAGCCAAGGG + Intronic
1181974003 22:26715150-26715172 CATCCACCTGTGACAACCAAGGG - Intergenic
1182151633 22:28031256-28031278 CAACCAACTGAGGCTCACAAAGG + Intronic
1182253010 22:29016812-29016834 CAAGCACCTGTAGCATGCTAGGG + Intronic
1183259939 22:36788177-36788199 CCACCACCTGTGGTCTACAGAGG + Intergenic
1184186090 22:42866401-42866423 CAGACACCTGTGGAAGACAAAGG - Intronic
955356911 3:58238733-58238755 CCAGCTCCTGGGGCATACAAAGG - Intronic
960202074 3:114848842-114848864 CATCCACCTGTGGCCCACATTGG - Intronic
966220671 3:177548070-177548092 GAACCCTCTGTGGCACACAAAGG + Intergenic
968271153 3:197404677-197404699 CAAGCACCTGAGCCACACAATGG + Intergenic
970477737 4:16440739-16440761 CAGTCACCTGTGGCAGCCAATGG - Intergenic
973784736 4:54324219-54324241 CAAGCTGCTGTGGCAGACAAGGG + Intergenic
974033767 4:56799326-56799348 AAATCACCTGTGGCAAACAAAGG + Intergenic
975275028 4:72487103-72487125 CAACAACCTTTGGCATACAGTGG - Intronic
977796329 4:101169463-101169485 CAACCACCTGTGGCAACCCTGGG + Intronic
979365899 4:119822815-119822837 AAACCACCAGTCACATACAAAGG + Intergenic
984770843 4:183435238-183435260 CAACCAACTGTCGCATAAAGGGG + Intergenic
987370462 5:17188108-17188130 CCCCCACCTGTGGCACACAGAGG + Intronic
991910680 5:71557823-71557845 CCACCACCTGTGGCCTATAATGG + Intronic
993267385 5:85743748-85743770 CCACCACCACTGGCCTACAAGGG - Intergenic
995246076 5:109937113-109937135 CAACCAGCTGTGGCTTAGAATGG - Intergenic
1000372163 5:160547569-160547591 CACTCACCTCAGGCATACAAGGG - Intergenic
1001411120 5:171512752-171512774 CAACCTCCTGGGGCCTACATTGG + Intergenic
1003151108 6:3549735-3549757 CAACCTCCTGTGACACACAATGG - Intergenic
1006671600 6:35732713-35732735 CAACTACCTGTGGAATCCTAAGG - Intergenic
1007038749 6:38702320-38702342 AAATGACCTGTTGCATACAAAGG - Intronic
1017635998 6:156443719-156443741 CAGCCCTCTGTGACATACAAGGG - Intergenic
1018628346 6:165801898-165801920 CATCCACCTTTGGCATATAATGG - Intronic
1021112665 7:16713412-16713434 CCACCACCTTTGGCCTAAAAAGG - Intergenic
1025975949 7:66370084-66370106 CAACCACATAAGACATACAAAGG - Intronic
1030840350 7:114344412-114344434 CAACCAATGTTGGCATACAATGG - Intronic
1033740685 7:144273583-144273605 CCACCAGCTGGGGCATAGAAGGG + Intergenic
1033753222 7:144376030-144376052 CCACCAGCTGGGGCATAGAAGGG - Intronic
1040551100 8:48438309-48438331 AACCCAGCTGTGGCATACACAGG - Intergenic
1045659289 8:104419953-104419975 CAACCAGCTGTGGGGTACATAGG + Intronic
1047511718 8:125520796-125520818 CACCCACCTTTAGCATTCAAAGG - Intergenic
1055225510 9:73990060-73990082 CAACAGCCTGAGGCATACATTGG + Intergenic
1061092414 9:128434086-128434108 CAACCACCTGTGGCATACAATGG - Exonic
1061559993 9:131395688-131395710 CCAGCACCTGTGGCATCCATGGG - Intronic
1195765821 X:108295843-108295865 CCACCAACTGTGGCATTAAATGG - Intronic
1197868496 X:131043670-131043692 CAACCACCTGTGGCTTTCCTGGG + Intergenic