ID: 1061093281

View in Genome Browser
Species Human (GRCh38)
Location 9:128439054-128439076
Sequence ATGGCTCCTGGCCTTGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061093270_1061093281 12 Left 1061093270 9:128439019-128439041 CCTGCACTCAGGCAGCTGGAGGG No data
Right 1061093281 9:128439054-128439076 ATGGCTCCTGGCCTTGGCCATGG No data
1061093266_1061093281 27 Left 1061093266 9:128439004-128439026 CCGCTGTCTGTCATGCCTGCACT No data
Right 1061093281 9:128439054-128439076 ATGGCTCCTGGCCTTGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061093281 Original CRISPR ATGGCTCCTGGCCTTGGCCA TGG Intergenic
No off target data available for this crispr