ID: 1061094101

View in Genome Browser
Species Human (GRCh38)
Location 9:128444485-128444507
Sequence AGCAGCCAGGGGTCCCAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061094094_1061094101 15 Left 1061094094 9:128444447-128444469 CCTAAGTCTTTAAATGTAATTGC No data
Right 1061094101 9:128444485-128444507 AGCAGCCAGGGGTCCCAAGTCGG No data
1061094091_1061094101 28 Left 1061094091 9:128444434-128444456 CCTGCCCGGCTGGCCTAAGTCTT No data
Right 1061094101 9:128444485-128444507 AGCAGCCAGGGGTCCCAAGTCGG No data
1061094093_1061094101 23 Left 1061094093 9:128444439-128444461 CCGGCTGGCCTAAGTCTTTAAAT No data
Right 1061094101 9:128444485-128444507 AGCAGCCAGGGGTCCCAAGTCGG No data
1061094092_1061094101 24 Left 1061094092 9:128444438-128444460 CCCGGCTGGCCTAAGTCTTTAAA No data
Right 1061094101 9:128444485-128444507 AGCAGCCAGGGGTCCCAAGTCGG No data
1061094090_1061094101 29 Left 1061094090 9:128444433-128444455 CCCTGCCCGGCTGGCCTAAGTCT No data
Right 1061094101 9:128444485-128444507 AGCAGCCAGGGGTCCCAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061094101 Original CRISPR AGCAGCCAGGGGTCCCAAGT CGG Intergenic
No off target data available for this crispr