ID: 1061094647

View in Genome Browser
Species Human (GRCh38)
Location 9:128448641-128448663
Sequence GCACTTTGGGAGGTGGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 635169
Summary {0: 667, 1: 6733, 2: 160784, 3: 254256, 4: 212729}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061094647_1061094658 20 Left 1061094647 9:128448641-128448663 CCCGCCTCCACCTCCCAAAGTGC 0: 667
1: 6733
2: 160784
3: 254256
4: 212729
Right 1061094658 9:128448684-128448706 ACTGCACCCAGCTGCTCATTTGG No data
1061094647_1061094662 28 Left 1061094647 9:128448641-128448663 CCCGCCTCCACCTCCCAAAGTGC 0: 667
1: 6733
2: 160784
3: 254256
4: 212729
Right 1061094662 9:128448692-128448714 CAGCTGCTCATTTGGATATAGGG No data
1061094647_1061094661 27 Left 1061094647 9:128448641-128448663 CCCGCCTCCACCTCCCAAAGTGC 0: 667
1: 6733
2: 160784
3: 254256
4: 212729
Right 1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061094647 Original CRISPR GCACTTTGGGAGGTGGAGGC GGG (reversed) Intergenic
Too many off-targets to display for this crispr