ID: 1061094648

View in Genome Browser
Species Human (GRCh38)
Location 9:128448642-128448664
Sequence AGCACTTTGGGAGGTGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 459057
Summary {0: 669, 1: 6563, 2: 162175, 3: 178428, 4: 111222}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061094648_1061094662 27 Left 1061094648 9:128448642-128448664 CCGCCTCCACCTCCCAAAGTGCT 0: 669
1: 6563
2: 162175
3: 178428
4: 111222
Right 1061094662 9:128448692-128448714 CAGCTGCTCATTTGGATATAGGG No data
1061094648_1061094658 19 Left 1061094648 9:128448642-128448664 CCGCCTCCACCTCCCAAAGTGCT 0: 669
1: 6563
2: 162175
3: 178428
4: 111222
Right 1061094658 9:128448684-128448706 ACTGCACCCAGCTGCTCATTTGG No data
1061094648_1061094661 26 Left 1061094648 9:128448642-128448664 CCGCCTCCACCTCCCAAAGTGCT 0: 669
1: 6563
2: 162175
3: 178428
4: 111222
Right 1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061094648 Original CRISPR AGCACTTTGGGAGGTGGAGG CGG (reversed) Intergenic
Too many off-targets to display for this crispr