ID: 1061094650

View in Genome Browser
Species Human (GRCh38)
Location 9:128448645-128448667
Sequence CCCAGCACTTTGGGAGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 673859
Summary {0: 983, 1: 9222, 2: 218829, 3: 263120, 4: 181705}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061094650_1061094662 24 Left 1061094650 9:128448645-128448667 CCTCCACCTCCCAAAGTGCTGGG 0: 983
1: 9222
2: 218829
3: 263120
4: 181705
Right 1061094662 9:128448692-128448714 CAGCTGCTCATTTGGATATAGGG No data
1061094650_1061094658 16 Left 1061094650 9:128448645-128448667 CCTCCACCTCCCAAAGTGCTGGG 0: 983
1: 9222
2: 218829
3: 263120
4: 181705
Right 1061094658 9:128448684-128448706 ACTGCACCCAGCTGCTCATTTGG No data
1061094650_1061094661 23 Left 1061094650 9:128448645-128448667 CCTCCACCTCCCAAAGTGCTGGG 0: 983
1: 9222
2: 218829
3: 263120
4: 181705
Right 1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061094650 Original CRISPR CCCAGCACTTTGGGAGGTGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr