ID: 1061094652

View in Genome Browser
Species Human (GRCh38)
Location 9:128448648-128448670
Sequence AATCCCAGCACTTTGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14635
Summary {0: 3798, 1: 3826, 2: 2729, 3: 1935, 4: 2347}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061094652_1061094662 21 Left 1061094652 9:128448648-128448670 CCACCTCCCAAAGTGCTGGGATT 0: 3798
1: 3826
2: 2729
3: 1935
4: 2347
Right 1061094662 9:128448692-128448714 CAGCTGCTCATTTGGATATAGGG No data
1061094652_1061094658 13 Left 1061094652 9:128448648-128448670 CCACCTCCCAAAGTGCTGGGATT 0: 3798
1: 3826
2: 2729
3: 1935
4: 2347
Right 1061094658 9:128448684-128448706 ACTGCACCCAGCTGCTCATTTGG No data
1061094652_1061094661 20 Left 1061094652 9:128448648-128448670 CCACCTCCCAAAGTGCTGGGATT 0: 3798
1: 3826
2: 2729
3: 1935
4: 2347
Right 1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061094652 Original CRISPR AATCCCAGCACTTTGGGAGG TGG (reversed) Intergenic
Too many off-targets to display for this crispr