ID: 1061094653

View in Genome Browser
Species Human (GRCh38)
Location 9:128448651-128448673
Sequence TGTAATCCCAGCACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1035426
Summary {0: 288135, 1: 266162, 2: 155564, 3: 133776, 4: 191789}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061094653_1061094661 17 Left 1061094653 9:128448651-128448673 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG No data
1061094653_1061094658 10 Left 1061094653 9:128448651-128448673 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1061094658 9:128448684-128448706 ACTGCACCCAGCTGCTCATTTGG No data
1061094653_1061094662 18 Left 1061094653 9:128448651-128448673 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1061094662 9:128448692-128448714 CAGCTGCTCATTTGGATATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061094653 Original CRISPR TGTAATCCCAGCACTTTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr