ID: 1061094655

View in Genome Browser
Species Human (GRCh38)
Location 9:128448654-128448676
Sequence GCCTGTAATCCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1038702
Summary {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061094655_1061094662 15 Left 1061094655 9:128448654-128448676 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1061094662 9:128448692-128448714 CAGCTGCTCATTTGGATATAGGG No data
1061094655_1061094661 14 Left 1061094655 9:128448654-128448676 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG No data
1061094655_1061094658 7 Left 1061094655 9:128448654-128448676 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1061094658 9:128448684-128448706 ACTGCACCCAGCTGCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061094655 Original CRISPR GCCTGTAATCCCAGCACTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr