ID: 1061094656

View in Genome Browser
Species Human (GRCh38)
Location 9:128448655-128448677
Sequence TGCCTGTAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 960678
Summary {0: 89533, 1: 228199, 2: 240322, 3: 214910, 4: 187714}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061094656_1061094661 13 Left 1061094656 9:128448655-128448677 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG No data
1061094656_1061094662 14 Left 1061094656 9:128448655-128448677 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1061094662 9:128448692-128448714 CAGCTGCTCATTTGGATATAGGG No data
1061094656_1061094658 6 Left 1061094656 9:128448655-128448677 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1061094658 9:128448684-128448706 ACTGCACCCAGCTGCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061094656 Original CRISPR TGCCTGTAATCCCAGCACTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr