ID: 1061094659

View in Genome Browser
Species Human (GRCh38)
Location 9:128448690-128448712
Sequence CTATATCCAAATGAGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061094659_1061094664 8 Left 1061094659 9:128448690-128448712 CCCAGCTGCTCATTTGGATATAG No data
Right 1061094664 9:128448721-128448743 TAAATGTAATCCGTTAAGATGGG No data
1061094659_1061094663 7 Left 1061094659 9:128448690-128448712 CCCAGCTGCTCATTTGGATATAG No data
Right 1061094663 9:128448720-128448742 GTAAATGTAATCCGTTAAGATGG No data
1061094659_1061094667 28 Left 1061094659 9:128448690-128448712 CCCAGCTGCTCATTTGGATATAG No data
Right 1061094667 9:128448741-128448763 GGGGCCCTGCTGAAGTAGAGTGG No data
1061094659_1061094665 9 Left 1061094659 9:128448690-128448712 CCCAGCTGCTCATTTGGATATAG No data
Right 1061094665 9:128448722-128448744 AAATGTAATCCGTTAAGATGGGG No data
1061094659_1061094668 29 Left 1061094659 9:128448690-128448712 CCCAGCTGCTCATTTGGATATAG No data
Right 1061094668 9:128448742-128448764 GGGCCCTGCTGAAGTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061094659 Original CRISPR CTATATCCAAATGAGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr