ID: 1061094661

View in Genome Browser
Species Human (GRCh38)
Location 9:128448691-128448713
Sequence CCAGCTGCTCATTTGGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061094652_1061094661 20 Left 1061094652 9:128448648-128448670 CCACCTCCCAAAGTGCTGGGATT 0: 3798
1: 3826
2: 2729
3: 1935
4: 2347
Right 1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG No data
1061094650_1061094661 23 Left 1061094650 9:128448645-128448667 CCTCCACCTCCCAAAGTGCTGGG 0: 983
1: 9222
2: 218829
3: 263120
4: 181705
Right 1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG No data
1061094648_1061094661 26 Left 1061094648 9:128448642-128448664 CCGCCTCCACCTCCCAAAGTGCT 0: 669
1: 6563
2: 162175
3: 178428
4: 111222
Right 1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG No data
1061094655_1061094661 14 Left 1061094655 9:128448654-128448676 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG No data
1061094656_1061094661 13 Left 1061094656 9:128448655-128448677 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG No data
1061094647_1061094661 27 Left 1061094647 9:128448641-128448663 CCCGCCTCCACCTCCCAAAGTGC 0: 667
1: 6733
2: 160784
3: 254256
4: 212729
Right 1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG No data
1061094653_1061094661 17 Left 1061094653 9:128448651-128448673 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1061094661 9:128448691-128448713 CCAGCTGCTCATTTGGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061094661 Original CRISPR CCAGCTGCTCATTTGGATAT AGG Intergenic
No off target data available for this crispr