ID: 1061094961

View in Genome Browser
Species Human (GRCh38)
Location 9:128451161-128451183
Sequence GACACTCTAGAGACGAGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061094952_1061094961 6 Left 1061094952 9:128451132-128451154 CCAGGCCCAGCCCCTGCGCTCCT No data
Right 1061094961 9:128451161-128451183 GACACTCTAGAGACGAGTGGAGG No data
1061094956_1061094961 -4 Left 1061094956 9:128451142-128451164 CCCCTGCGCTCCTGAAGTGGACA No data
Right 1061094961 9:128451161-128451183 GACACTCTAGAGACGAGTGGAGG No data
1061094954_1061094961 0 Left 1061094954 9:128451138-128451160 CCAGCCCCTGCGCTCCTGAAGTG No data
Right 1061094961 9:128451161-128451183 GACACTCTAGAGACGAGTGGAGG No data
1061094950_1061094961 12 Left 1061094950 9:128451126-128451148 CCTGGCCCAGGCCCAGCCCCTGC No data
Right 1061094961 9:128451161-128451183 GACACTCTAGAGACGAGTGGAGG No data
1061094953_1061094961 1 Left 1061094953 9:128451137-128451159 CCCAGCCCCTGCGCTCCTGAAGT No data
Right 1061094961 9:128451161-128451183 GACACTCTAGAGACGAGTGGAGG No data
1061094951_1061094961 7 Left 1061094951 9:128451131-128451153 CCCAGGCCCAGCCCCTGCGCTCC No data
Right 1061094961 9:128451161-128451183 GACACTCTAGAGACGAGTGGAGG No data
1061094958_1061094961 -6 Left 1061094958 9:128451144-128451166 CCTGCGCTCCTGAAGTGGACACT No data
Right 1061094961 9:128451161-128451183 GACACTCTAGAGACGAGTGGAGG No data
1061094957_1061094961 -5 Left 1061094957 9:128451143-128451165 CCCTGCGCTCCTGAAGTGGACAC No data
Right 1061094961 9:128451161-128451183 GACACTCTAGAGACGAGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061094961 Original CRISPR GACACTCTAGAGACGAGTGG AGG Intergenic
No off target data available for this crispr