ID: 1061099152

View in Genome Browser
Species Human (GRCh38)
Location 9:128478958-128478980
Sequence AGTGCATGGCTCTTAGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061099142_1061099152 15 Left 1061099142 9:128478920-128478942 CCAGCCTTAGTCTCCTCCTCTGA No data
Right 1061099152 9:128478958-128478980 AGTGCATGGCTCTTAGAGTAGGG No data
1061099140_1061099152 27 Left 1061099140 9:128478908-128478930 CCTTCACTTCTCCCAGCCTTAGT No data
Right 1061099152 9:128478958-128478980 AGTGCATGGCTCTTAGAGTAGGG No data
1061099143_1061099152 11 Left 1061099143 9:128478924-128478946 CCTTAGTCTCCTCCTCTGAGATG No data
Right 1061099152 9:128478958-128478980 AGTGCATGGCTCTTAGAGTAGGG No data
1061099149_1061099152 -1 Left 1061099149 9:128478936-128478958 CCTCTGAGATGGGGGTAGTGATA No data
Right 1061099152 9:128478958-128478980 AGTGCATGGCTCTTAGAGTAGGG No data
1061099141_1061099152 16 Left 1061099141 9:128478919-128478941 CCCAGCCTTAGTCTCCTCCTCTG No data
Right 1061099152 9:128478958-128478980 AGTGCATGGCTCTTAGAGTAGGG No data
1061099148_1061099152 2 Left 1061099148 9:128478933-128478955 CCTCCTCTGAGATGGGGGTAGTG No data
Right 1061099152 9:128478958-128478980 AGTGCATGGCTCTTAGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061099152 Original CRISPR AGTGCATGGCTCTTAGAGTA GGG Intronic