ID: 1061099664

View in Genome Browser
Species Human (GRCh38)
Location 9:128483186-128483208
Sequence AAAAATGCACAACTGCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 322}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061099664_1061099667 -1 Left 1061099664 9:128483186-128483208 CCCAGCCGCAGTTGTGCATTTTT 0: 1
1: 0
2: 3
3: 20
4: 322
Right 1061099667 9:128483208-128483230 TATGAGCCAGTAGAATATAATGG No data
1061099664_1061099670 16 Left 1061099664 9:128483186-128483208 CCCAGCCGCAGTTGTGCATTTTT 0: 1
1: 0
2: 3
3: 20
4: 322
Right 1061099670 9:128483225-128483247 TAATGGATATGCAGAGAGCTGGG No data
1061099664_1061099669 15 Left 1061099664 9:128483186-128483208 CCCAGCCGCAGTTGTGCATTTTT 0: 1
1: 0
2: 3
3: 20
4: 322
Right 1061099669 9:128483224-128483246 ATAATGGATATGCAGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061099664 Original CRISPR AAAAATGCACAACTGCGGCT GGG (reversed) Intronic
900873698 1:5326001-5326023 AAACATACACACCTGAGGCTTGG + Intergenic
901089444 1:6631607-6631629 AAAAATACAAAAATTCGGCTGGG + Intronic
901365418 1:8743554-8743576 AAAAATGGCCAAGTGTGGCTGGG - Intronic
901891977 1:12274605-12274627 AAAAATACACCACTGGGGCTGGG - Intronic
902029993 1:13415375-13415397 AAAAATGAACCACTTTGGCTGGG - Intronic
902772652 1:18654597-18654619 AAAAAACCACAACAGCGGGTGGG + Intronic
903696815 1:25213813-25213835 AAAAATACAGAACTGGGGCCAGG + Intergenic
903910288 1:26719643-26719665 AAAAAGGTACAACTGAGGCCGGG + Intronic
904672420 1:32175800-32175822 AAAAATCCACATCTTCAGCTGGG + Exonic
904947606 1:34210945-34210967 AAAAATCCACAAAGGGGGCTGGG - Intronic
905086156 1:35379392-35379414 AAAAATGCAAAACTTAGGCAGGG - Intronic
906121245 1:43392706-43392728 AAAAATGCTTAACTTAGGCTGGG - Intronic
908489809 1:64632151-64632173 AAATATGCACAACCTCTGCTTGG - Intronic
908805935 1:67932166-67932188 AGAAATCAACAACAGCGGCTGGG - Intergenic
911353582 1:96787315-96787337 AAAAATGAACAAAAGCGGCCAGG - Intronic
913552585 1:119930481-119930503 AAAAAGGCACAAAAGAGGCTGGG + Intronic
914809303 1:151015030-151015052 AAAAATGCAAAAATTTGGCTGGG + Intronic
916228645 1:162517001-162517023 AGAAATACACAAGTGAGGCTGGG + Intronic
916231744 1:162547461-162547483 AAAAATTCACAACTGCCATTTGG + Intergenic
916584959 1:166142367-166142389 AAGACTGCACAGCTGAGGCTAGG + Intronic
917434724 1:175008895-175008917 ATAGAAGCACAACTGCGCCTAGG - Intronic
917557643 1:176107042-176107064 ATAAATACACTACTGCTGCTGGG + Intronic
918249990 1:182694509-182694531 AAAAATGCTTATCTGTGGCTGGG + Intergenic
919245525 1:194978113-194978135 AAAAATACACATATGCGGCTGGG - Intergenic
919642321 1:200057774-200057796 AAAAAAGCACAATTACGGCCAGG - Intronic
920341455 1:205277662-205277684 AAAAATACAAAAATGAGGCTGGG - Intergenic
921585878 1:216945883-216945905 AAAAAAACAGAACTGAGGCTTGG - Intronic
923612629 1:235508888-235508910 ATGAATGCAAAACTGTGGCTTGG - Intergenic
1062878662 10:961257-961279 ATAAAGGCACACCTGAGGCTGGG + Intergenic
1065031273 10:21588706-21588728 AGAAATGCAAAACTACTGCTTGG - Intronic
1065302079 10:24331958-24331980 AAAAATGCAAAACATCAGCTGGG - Intronic
1065469209 10:26059960-26059982 AAAAATACAAAACTTAGGCTGGG + Intronic
1066501212 10:35996580-35996602 AGAAATGTACAACTGTGGTTGGG + Intergenic
1067104454 10:43356844-43356866 AAAAATGCAAAAATTAGGCTGGG + Intergenic
1069809311 10:71146686-71146708 AATAATGCAGAACTGTGGCATGG - Intergenic
1072033397 10:91542307-91542329 AAAAATGCATCAGTGGGGCTGGG - Intergenic
1072767362 10:98106395-98106417 AGGAATGAACAAGTGCGGCTTGG - Intergenic
1073940062 10:108686868-108686890 AAATATCAACAACTGCGTCTAGG - Intergenic
1076550417 10:131274353-131274375 AAAACTGAACAAGTGCAGCTGGG - Intronic
1077006264 11:358888-358910 AAAAATGCTAAACTGGGGCCGGG + Intergenic
1077609475 11:3635649-3635671 AAAAATGTTCAACTACGTCTTGG - Intergenic
1078075105 11:8151616-8151638 AAAAATAAACAACTGTGGCCAGG + Intronic
1079162340 11:18006692-18006714 AAAGATGGGCAACTGGGGCTTGG - Exonic
1079341512 11:19615558-19615580 ATAAATGCAAAACAGTGGCTAGG + Intronic
1081203825 11:40251053-40251075 CAAAATGTACTACTGCTGCTTGG - Intronic
1082257900 11:50052513-50052535 AAAAATACAAAACTTTGGCTGGG + Intergenic
1084324393 11:68391262-68391284 AAATATGCTCAACAGAGGCTGGG - Intronic
1084442784 11:69184972-69184994 AAAAATACACAAATTAGGCTGGG - Intergenic
1085509196 11:77077808-77077830 AAAAATGCTCAACATTGGCTGGG - Intronic
1086082982 11:82924517-82924539 AAAAATAAACAAATGAGGCTGGG + Intronic
1087000879 11:93419193-93419215 AAAAAGACAGAACTGTGGCTTGG + Intronic
1087128624 11:94650433-94650455 CAAAATGCACAAATGAGGCAAGG - Intergenic
1087927416 11:103935225-103935247 AAAGACGGACAACTGCGTCTAGG + Intronic
1088624163 11:111717017-111717039 AAAAAAGCTCAACAGCGGCCGGG + Intronic
1091548725 12:1521879-1521901 AAAAATACAAAACTTAGGCTGGG + Intergenic
1092054627 12:5498778-5498800 AAAAATCCTCCACTGAGGCTTGG + Intronic
1093572753 12:20686848-20686870 AAAAATGCAGAGCTGTGGATTGG + Intergenic
1094691583 12:32774752-32774774 AAAAATACAAAACTTAGGCTGGG - Intergenic
1096349882 12:50888506-50888528 AAGATTGCACCACTGCAGCTTGG + Intergenic
1096674846 12:53220960-53220982 AAAAGTGCATTCCTGCGGCTCGG + Intronic
1099468923 12:83022373-83022395 AGCAATGCACAACTGGGGCGGGG - Intronic
1099677628 12:85782669-85782691 TAAAACGCACAACTGAGGATGGG - Intergenic
1100595394 12:96067532-96067554 AAAAATGTAAAACTTTGGCTGGG + Intergenic
1101315051 12:103621436-103621458 AGAAATGCAAAACTGAGGTTGGG + Intronic
1101357361 12:103993034-103993056 TAAAATGCACATTTGCGGCCGGG + Intronic
1101465871 12:104948920-104948942 ATAAATGAACAAATACGGCTGGG + Intronic
1102776775 12:115526488-115526510 AAGAAAGCACCACTGCTGCTGGG + Intergenic
1104022331 12:125001349-125001371 AAAAATGCATAATTGGGGCCGGG - Intronic
1105818708 13:24060765-24060787 AAAAATGGACAAATGCGGCTGGG + Intronic
1105955471 13:25278295-25278317 TAAAATGCACAACTGCTACCGGG + Intronic
1106177074 13:27340709-27340731 AAAAATGCTCAACAGCGGCAGGG + Intergenic
1106271476 13:28158580-28158602 AAAAATGCTCAACATTGGCTGGG + Intronic
1107177182 13:37412254-37412276 AAGAATCCACAAATGAGGCTGGG + Intergenic
1107905467 13:45057285-45057307 AAAAATACAAAACTTAGGCTGGG - Intergenic
1110697219 13:78504872-78504894 AAAAATACACATATACGGCTGGG - Intergenic
1111851593 13:93582889-93582911 AAAACTGCACAACTGTCTCTAGG - Intronic
1112210688 13:97374440-97374462 AAGATTGCACCACTGCGGCCGGG - Intronic
1112744448 13:102510842-102510864 AAAAATATTCAACTGCTGCTTGG + Intergenic
1113236987 13:108288324-108288346 AAATATGCACAAATGCTCCTTGG + Intronic
1114457189 14:22863460-22863482 AAAAATGCAAAATTCAGGCTGGG - Intergenic
1115656877 14:35451778-35451800 AAAAATGTACAATTAAGGCTGGG + Intergenic
1116560163 14:46368487-46368509 AGACATGCACAACTGTGACTTGG - Intergenic
1117406287 14:55407422-55407444 AAAAATGCAAAAATGAGGCCGGG - Intronic
1118100889 14:62601343-62601365 AAAAATAGACAAATGGGGCTGGG + Intergenic
1118277926 14:64402599-64402621 AAAAAAGCACAAGTGCAGCCTGG + Intronic
1118843692 14:69530172-69530194 ACACATGCACATCTGCTGCTAGG + Exonic
1119696203 14:76715199-76715221 AAAAATGCACACATCTGGCTGGG - Intergenic
1120866662 14:89301096-89301118 AAAAATAAACATCTGAGGCTGGG - Intronic
1122141428 14:99665204-99665226 AAAAATGGACAATTTCGGCTGGG - Intronic
1122361762 14:101171639-101171661 AAAAATGCAGAACTGGGTCATGG - Intergenic
1124525086 15:30443412-30443434 AAAAATGCAAGAGTGTGGCTGGG + Intergenic
1124773568 15:32564301-32564323 AAAAATGCAAGAGTGTGGCTGGG - Intergenic
1125688838 15:41580213-41580235 AAAAATGCAAAAAATCGGCTGGG + Exonic
1126195829 15:45929988-45930010 ACAAATGCAAAACAGCTGCTAGG + Intergenic
1126603022 15:50447896-50447918 AAAAATGCAAAAATTAGGCTGGG - Intronic
1127069995 15:55279517-55279539 AAAAATGTACAACTACAGTTAGG + Intronic
1127108400 15:55642319-55642341 AAAAATATACAACTCAGGCTGGG + Intronic
1127168365 15:56271843-56271865 AAAAATGTACAATTTAGGCTGGG + Intronic
1128017614 15:64361254-64361276 AAAAATGTTCAACTGAGCCTTGG - Intronic
1129097403 15:73223726-73223748 AAAGATACACAACTGCGGAATGG - Intronic
1129141459 15:73601915-73601937 AAAATTGCATAACTGGGGATGGG + Intronic
1131085364 15:89571621-89571643 AAAAATGAACAAGTGTGGCCGGG - Intergenic
1131213513 15:90518056-90518078 AGAAATGCACAGTTGAGGCTGGG + Intergenic
1133977769 16:10612304-10612326 AAAAATGCAGATCTGAGGCTGGG + Intergenic
1134166286 16:11932480-11932502 AAAAATGCAAAAATTGGGCTGGG + Intronic
1135314013 16:21428555-21428577 AAAAATGCAAAAATTAGGCTGGG - Intronic
1135366937 16:21860835-21860857 AAAAATGCAAAAATTAGGCTGGG - Intronic
1135444878 16:22510327-22510349 AAAAATGCAAAAATTAGGCTGGG + Intronic
1136130260 16:28215892-28215914 AAAAATACAAAAATGAGGCTGGG + Intergenic
1136155327 16:28378251-28378273 ACAAATTCACAGCTGGGGCTGGG - Intergenic
1136193599 16:28634870-28634892 AAAAATGCAAAAATTAGGCTGGG + Intergenic
1136207756 16:28737037-28737059 ACAAATTCACAGCTGGGGCTGGG + Intergenic
1136310683 16:29407262-29407284 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1136324124 16:29509044-29509066 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1136438809 16:30249027-30249049 AAAAATGCAAAAATTAGGCTGGG - Intronic
1139139545 16:64244385-64244407 AAAAATTCACAACAGGGGCCGGG - Intergenic
1139522864 16:67495086-67495108 AAAAATACAAAACTTAGGCTGGG + Intergenic
1139608024 16:68033925-68033947 AAAAATGCAAAAATTGGGCTGGG - Intronic
1139823790 16:69741078-69741100 AAAAAAGCACAGATGGGGCTGGG + Intergenic
1139841198 16:69882113-69882135 AAAAATACAAAACTTAGGCTGGG - Intronic
1139933155 16:70546354-70546376 AAAAATGCATATGTGCGGCTGGG + Intronic
1139970115 16:70769109-70769131 AAAAATGCACATCCACAGCTGGG - Intronic
1141122352 16:81369863-81369885 AAAAAAGCAAAACATCGGCTGGG - Intronic
1143561860 17:7701262-7701284 AAAAATACAAAAATGAGGCTGGG - Intronic
1143704785 17:8689158-8689180 AAAAATGCACAAAACCAGCTGGG - Intergenic
1145000039 17:19298167-19298189 AAAAATACATAAATGAGGCTGGG - Intronic
1145239664 17:21233098-21233120 AAAAATATATAACTGTGGCTGGG - Intergenic
1146039482 17:29437355-29437377 AAAAATGCAAAACTTAGGCCAGG - Intronic
1147061330 17:37881221-37881243 AAAGATCAACAACTGTGGCTGGG + Intergenic
1147851886 17:43450099-43450121 AAAAACCCACAGCTGCTGCTAGG - Intergenic
1147874398 17:43610860-43610882 AAAAATGCAAAAATTTGGCTGGG - Intergenic
1148410612 17:47463663-47463685 AAAGATCAACAACTGTGGCTGGG + Intergenic
1148453215 17:47794660-47794682 AAAAATGCAGAAATGCGGAGAGG - Intergenic
1149061483 17:52427955-52427977 AAAAAAAGACACCTGCGGCTGGG + Intergenic
1149739421 17:59030400-59030422 AAAAATTAAGAACTGGGGCTGGG - Intronic
1150305108 17:64078026-64078048 AGAAATGCACATTTGTGGCTGGG - Intronic
1150743636 17:67799213-67799235 AAAAATGCACAGGATCGGCTGGG - Intergenic
1150921952 17:69493463-69493485 AAAAATACTCAGCTGCAGCTGGG + Intronic
1151273088 17:73011955-73011977 AAAAATGTACAACTAGGGCCAGG - Intronic
1151797428 17:76355642-76355664 AAAAATGCAAAAATTAGGCTGGG + Intronic
1152256022 17:79239905-79239927 ATAAATGCACATCCGTGGCTGGG - Intronic
1154119809 18:11642917-11642939 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1154296871 18:13159130-13159152 AAAAATTCACTACAGGGGCTGGG - Intergenic
1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG + Intergenic
1155004534 18:21716554-21716576 AAAAATGCTCCACTTAGGCTGGG + Intronic
1156021867 18:32608614-32608636 AAAAATGTACAACAGCAGCCAGG - Intergenic
1156336000 18:36172035-36172057 AAAAATGCCTAAATGTGGCTGGG + Intronic
1156795132 18:41035400-41035422 AAAACTACTCAGCTGCGGCTGGG - Intergenic
1157754739 18:50207631-50207653 AAAAATATACAGCTGGGGCTGGG - Intergenic
1157844487 18:50990445-50990467 AAAAATGCACACTTGTGGCCAGG + Intronic
1159709844 18:71743576-71743598 AAAAATTCACAAGTGAGGCCCGG + Intronic
1161139541 19:2639494-2639516 AAGATTTCACAGCTGCGGCTGGG + Intronic
1161607642 19:5223544-5223566 AAAAAATCACAACCGCAGCTGGG - Intronic
1161825217 19:6559056-6559078 AAAAATGCAAAAATTCGGCCAGG - Intergenic
1162159773 19:8703115-8703137 AAAAATACAAAACTTAGGCTGGG - Intergenic
1163016936 19:14462152-14462174 AAAAATACAAAAATTCGGCTGGG + Intronic
1164495128 19:28753808-28753830 AAAAATGTAATAATGCGGCTGGG - Intergenic
1165058335 19:33193143-33193165 AAAAATGCTCAACAGAGGCAGGG - Intronic
1165356685 19:35308817-35308839 AAAAATGGTCAAATGTGGCTGGG + Intronic
1165369432 19:35395202-35395224 AAAAAAGCATAACTGGGGCTGGG - Intergenic
1166363325 19:42265507-42265529 AAAAATACAAAAATTCGGCTGGG - Intergenic
1167285841 19:48598593-48598615 AAAAATGGAAAACTGAGGCTTGG + Intronic
1168090319 19:54078660-54078682 AAAAATACAAAAATGAGGCTGGG - Intronic
1168213764 19:54910274-54910296 AAAAATACAAAACTTAGGCTGGG + Intronic
925518880 2:4718634-4718656 AAAAATACACTACGGCGGCCAGG + Intergenic
926489303 2:13504208-13504230 AAAAATACACAAATTAGGCTAGG - Intergenic
927976334 2:27341329-27341351 AAAAATACACAATTGAGGCTGGG - Intronic
928095391 2:28401668-28401690 AAAAATGGCCAATTGGGGCTGGG - Intronic
930431410 2:51281201-51281223 AAAAATTGACAATTGCGGCCGGG - Intergenic
930759367 2:55016285-55016307 AAAAATACACATATGCGGCCAGG + Intronic
931645058 2:64414641-64414663 AAAAAGTCACAACTGGGGATGGG - Intergenic
931728663 2:65133762-65133784 AAAAAAACAAAACTGGGGCTTGG + Intergenic
932033134 2:68211109-68211131 AAAAATACTCCATTGCGGCTGGG + Intronic
932809082 2:74808940-74808962 ATAAAAGTACAACTGTGGCTGGG + Intergenic
932966259 2:76478817-76478839 TAAAAGGAACAGCTGCGGCTGGG - Intergenic
933738219 2:85512396-85512418 AAAAATGAAAAACAGGGGCTGGG - Intergenic
933740749 2:85532136-85532158 AAAAATATACACCTGTGGCTGGG + Intergenic
933868708 2:86546731-86546753 AAAGATGTCCAACTTCGGCTGGG - Intronic
933887748 2:86735700-86735722 AAAAATACAAAAATGTGGCTGGG - Intronic
933922429 2:87061012-87061034 AAAAATACAAAAATGTGGCTGGG + Intergenic
936057774 2:109273656-109273678 AAACATGCGCAACTGCTGATGGG + Intronic
936288950 2:111203627-111203649 ACAAATGCACAAATGGGGCCGGG - Intergenic
936563438 2:113562149-113562171 AGAAATGCAGAACTTCAGCTGGG - Intergenic
938300235 2:130205613-130205635 AAAAATGTAAAAATGCGGCTGGG - Intergenic
938456487 2:131468882-131468904 AAAAATGTAAAAATGCGGCTGGG + Intronic
938705521 2:133921260-133921282 AAAAATGCACCACTGTGGTGGGG - Intergenic
940115243 2:150201269-150201291 AAAAACACACAACTTGGGCTGGG - Intergenic
940182516 2:150951574-150951596 AAAAATACACAACAGAGACTGGG + Intergenic
941187217 2:162332012-162332034 TAAAATACACAACTTCTGCTGGG + Intronic
941824151 2:169874462-169874484 AAAAATGCAGAATTTTGGCTGGG - Intronic
942537663 2:176982435-176982457 CAAAATGCAAACCTGTGGCTTGG - Intergenic
943294527 2:186119817-186119839 AAAAATACAAAACTGCTACTCGG + Intergenic
944345190 2:198656100-198656122 ATAAATGCACAACTGTGATTTGG + Intergenic
944713396 2:202355933-202355955 AAAAATGGACAAATGGGGCCAGG - Intergenic
944791954 2:203140003-203140025 GAAAATACACAAAAGCGGCTGGG + Intronic
947429862 2:230017900-230017922 AAAAATGCCCAACAGTGGCCGGG + Intergenic
947868340 2:233417326-233417348 AAAAATGCACAAGGGGGGCTAGG - Intronic
1170206298 20:13802371-13802393 AAAAATGCAAATGTGTGGCTGGG + Intronic
1172801362 20:37578709-37578731 AAAAATACAAAACTTAGGCTTGG - Intergenic
1176843188 21:13856700-13856722 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176845876 21:13876046-13876068 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176848611 21:13895601-13895623 AAAGATGCACAGCTACAGCTTGG - Intergenic
1177316347 21:19466598-19466620 AAAATTGCTCAAGTGTGGCTGGG - Intergenic
1180644403 22:17326719-17326741 AAAAAAGAAAAACTGGGGCTGGG + Intergenic
1180644719 22:17329192-17329214 ACACATGCACAACTGCTGCGTGG + Intergenic
1181536563 22:23549331-23549353 AGAAATCCCCAACTGCTGCTGGG + Intergenic
1182315924 22:29447191-29447213 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1182656290 22:31892761-31892783 AAAAATGGACTACTCCGTCTGGG - Intronic
1182743029 22:32582675-32582697 AAAAATGCAGAACATAGGCTGGG - Intronic
1183851885 22:40596504-40596526 AAAAATGCAAAAATTAGGCTGGG + Intronic
1183982920 22:41552969-41552991 AAAAATACAAAAATGAGGCTGGG - Intergenic
1184008029 22:41725095-41725117 AATAATTTACAACTGAGGCTAGG - Intronic
949186047 3:1192635-1192657 ACAGATGCACACCTGCTGCTAGG + Intronic
950226698 3:11241536-11241558 TAAAATGCACCACTCAGGCTGGG + Intronic
951629784 3:24707183-24707205 AAAACTGCAGAACTGAAGCTAGG - Intergenic
953698195 3:45176226-45176248 AATACTGCACAACTGAGGCAGGG + Intergenic
955456052 3:59122890-59122912 AAAAAGGAATAACTGAGGCTGGG + Intergenic
955901696 3:63763037-63763059 AAAAATGCACCACTCTGGCAAGG + Intergenic
958179106 3:90034924-90034946 AAAAATCAACTACTGGGGCTGGG + Intergenic
958752865 3:98213288-98213310 GAGAATGCACACCTGCGGGTGGG + Intergenic
959342663 3:105150084-105150106 ATAAAGGCACACCTGAGGCTGGG + Intergenic
960821612 3:121738965-121738987 AAAAATGAACTACTGAGGCCAGG + Intronic
961038680 3:123661751-123661773 AAATATGGACAACTGGGGGTGGG + Intronic
962549530 3:136475492-136475514 AAAAATCCCCAACTCAGGCTTGG + Intronic
963600356 3:147373053-147373075 AAGGAGGCACAACTGCAGCTCGG + Intergenic
963765207 3:149327477-149327499 AAAAATCCAGAGCTGGGGCTTGG + Intronic
964492119 3:157248121-157248143 AAAAATTCATAACTCTGGCTGGG + Intergenic
965313304 3:167158867-167158889 CAAGATGAACAACTGTGGCTTGG + Intergenic
966988234 3:185202040-185202062 AAAAAATCACAAGTGAGGCTGGG + Intronic
967075315 3:185996577-185996599 CAAAAGGCACAACAGGGGCTAGG + Intergenic
967425397 3:189321293-189321315 AGAAATGCAAAACTGAGTCTTGG - Exonic
967955379 3:194873705-194873727 AAAAAATCACATCTGGGGCTGGG + Intergenic
967997105 3:195174907-195174929 ACAGATGTACAACTGTGGCTGGG - Intronic
968231603 3:197007846-197007868 AGAAAGGCACAACTGTGGCCCGG - Intronic
968674019 4:1867490-1867512 AAAAATGCAAAAATTGGGCTGGG - Intergenic
968999130 4:3965794-3965816 AAAAATGCAAAACTATAGCTGGG - Intergenic
969667506 4:8569021-8569043 AAAAATGCACTAATACGGCCTGG - Intronic
970595117 4:17593091-17593113 AAAAATGCCCAGCTTTGGCTGGG - Intronic
972246898 4:37254736-37254758 AAAGATGAAAAACTGCAGCTTGG + Intronic
972805461 4:42525881-42525903 AGAAATTCAGAATTGCGGCTTGG - Intronic
974035025 4:56810541-56810563 AAAAATACAAAACTTAGGCTGGG + Intronic
974955252 4:68631497-68631519 AAAAATACACAGCTGCTACTCGG - Intronic
976243695 4:82986433-82986455 AAAAATACACCACCCCGGCTGGG + Intronic
976716249 4:88125311-88125333 AAAACTGCACAACTATGACTGGG + Intronic
979458389 4:120952132-120952154 AAAAATTCATAACTTTGGCTTGG + Intergenic
979772694 4:124548464-124548486 ATAAATGAATAACTGAGGCTGGG - Intergenic
982764783 4:159333271-159333293 AAAAGTCCAAACCTGCGGCTGGG - Intronic
983404647 4:167312793-167312815 AAAAATGAACAACTCAGGCCTGG + Intergenic
983958841 4:173728019-173728041 AAAAAAACAAAACTGCAGCTAGG + Intergenic
984944057 4:184957479-184957501 ATAAAGGAACACCTGCGGCTAGG + Intergenic
985004830 4:185523911-185523933 AAAAATGTACGACTTCGGCCGGG - Intronic
985258569 4:188093376-188093398 AAAAACGCACAGCTGTGGCTGGG + Intronic
985562328 5:594832-594854 ACAGATGCACAACTCTGGCTTGG - Intergenic
987710890 5:21499652-21499674 AAGAATTCAGAACTGGGGCTGGG - Intergenic
987995451 5:25271093-25271115 AAAAAAGAACACCTGAGGCTTGG - Intergenic
989396762 5:40965333-40965355 AAAAATGTATCACTGCAGCTCGG - Intronic
989437735 5:41434393-41434415 AAAAATGTACAATTGCAACTGGG + Intronic
991403896 5:66283007-66283029 TAAACTGCACAAATGGGGCTAGG - Intergenic
991761230 5:69918712-69918734 AAGAATTCAGAACTGGGGCTGGG - Intergenic
991786099 5:70199388-70199410 AAGAATTCAGAACTGGGGCTGGG + Intergenic
991840458 5:70793763-70793785 AAGAATTCAGAACTGGGGCTGGG - Intergenic
991878543 5:71199776-71199798 AAGAATTCAGAACTGGGGCTGGG + Intergenic
992437691 5:76771094-76771116 AAAAACGAACTACTGAGGCTGGG + Intergenic
992702259 5:79352650-79352672 AAAAATACACTAATGCGGCTGGG - Intergenic
993234475 5:85286079-85286101 TAAAATGCACACATGCGGCTGGG + Intergenic
994777562 5:104053583-104053605 AAAAATGCAAAACTTCTGCATGG - Intergenic
997143693 5:131409885-131409907 AAAAATGGACAAATGGGGCCGGG + Intergenic
998356415 5:141540573-141540595 AAAAATACAAAACTTAGGCTGGG - Intronic
998782878 5:145677816-145677838 AAAAATTCACCACTGAGGCCAGG + Intronic
999648978 5:153747084-153747106 ATAAAGGAACAACTGAGGCTAGG + Intronic
1000215818 5:159154998-159155020 AAAAATGTACCATTGAGGCTGGG + Intergenic
1002086120 5:176776672-176776694 GCAATAGCACAACTGCGGCTGGG + Intergenic
1003034468 6:2631205-2631227 AAACATGCACAGCTGCTGGTGGG - Intronic
1003547243 6:7069797-7069819 TAAAATGTACAACAGGGGCTGGG + Intergenic
1005546798 6:26880845-26880867 AAGAATTCAGAACTGAGGCTGGG + Intergenic
1008066314 6:47052784-47052806 AAAAATGCATTATTTCGGCTGGG + Intergenic
1008165565 6:48134178-48134200 AAAAATCCATAAGTGAGGCTAGG - Intergenic
1009017555 6:57921929-57921951 AAGAATTCAGAACTGGGGCTGGG + Intergenic
1010749134 6:79598785-79598807 AAAAGTGCTCAACCTCGGCTGGG + Intergenic
1011587246 6:88940050-88940072 AAAAAAGAAAAACTGGGGCTGGG - Intronic
1012283755 6:97363102-97363124 AAAAATGTACAAATGTGGCCAGG + Intergenic
1012500480 6:99882633-99882655 ACAAATGAATAACTGAGGCTGGG - Intergenic
1013482673 6:110565769-110565791 AGAAATGCAGAACCTCGGCTGGG - Intergenic
1015966894 6:138703205-138703227 AAAAATGCAAAACATCAGCTGGG + Intergenic
1017073495 6:150597946-150597968 AGAAATGCATAACTGAGGCCAGG + Intergenic
1017424892 6:154310057-154310079 AAAAATGCACAGCGACGGCCGGG - Intronic
1017493522 6:154964782-154964804 AAAAATGCATAATTCTGGCTGGG - Intronic
1017620112 6:156287823-156287845 TAAAATGCACATATGGGGCTGGG + Intergenic
1017806201 6:157947608-157947630 AAAAATGCAGAACTGGGGCTAGG + Intergenic
1018322109 6:162622341-162622363 AAAAATGCAAAAATTCGCCTGGG - Intronic
1023215891 7:37862204-37862226 CAAAATGCACTACTGGTGCTAGG + Intronic
1023216079 7:37864520-37864542 CAAAATGCACTACTGGTGCTAGG + Intronic
1024321624 7:48076994-48077016 AAAGATGCTCAACATCGGCTAGG + Intergenic
1026325492 7:69305847-69305869 AAAAAGGAATAACTGAGGCTGGG - Intergenic
1026589236 7:71681194-71681216 GGAAATGCAAAACTGGGGCTGGG - Intronic
1027388708 7:77683564-77683586 AAAAATACACAAATTAGGCTGGG - Intergenic
1028264272 7:88703829-88703851 AAAAATGGACAAATACGGCCAGG - Intergenic
1030041970 7:105459775-105459797 AAAAATGCACAACTGGGGCCAGG + Intronic
1030498855 7:110334072-110334094 AAAAATGCAAAACATTGGCTGGG - Intergenic
1031748903 7:125544954-125544976 AAAAAAACAAAACTGCGGCATGG + Intergenic
1032034765 7:128513659-128513681 AAAAATGCAAAAATTAGGCTGGG - Intergenic
1032371829 7:131363190-131363212 AAAAATTCACAAATGCGGCCTGG - Intronic
1033103967 7:138501988-138502010 AAAAAGGTACATCTGGGGCTTGG + Intronic
1033204590 7:139407055-139407077 AAAAATACACAAAAGTGGCTGGG - Intronic
1034157849 7:148970060-148970082 AAAAATGCAAAACTTAGGCTGGG - Intergenic
1035433913 7:158843553-158843575 AAAAATACAAAAATGAGGCTGGG - Intergenic
1037630437 8:20650862-20650884 AAAAAGTCACAACTGAGGTTAGG + Intergenic
1037841563 8:22248847-22248869 AAAAAGGGACATCTGAGGCTAGG - Intronic
1038766935 8:30437493-30437515 AAAAATGCAAAAATTAGGCTGGG + Intronic
1039491367 8:37950023-37950045 ATAAAGGCACACCTGAGGCTGGG - Intergenic
1040051284 8:43016876-43016898 AAAAATGCAAAGCTGAGGTTGGG + Intronic
1040717659 8:50277121-50277143 AAAAATGCACCACTTTGGCCAGG - Intronic
1041652597 8:60315765-60315787 AAACTTACACAACTGGGGCTGGG + Intergenic
1042394362 8:68275096-68275118 AAATATGCACAACTGAGTTTTGG - Intergenic
1042540463 8:69902689-69902711 AAAAATAAACAAATGGGGCTGGG - Intergenic
1044853920 8:96455249-96455271 TAAGATGCTCAACTGTGGCTGGG - Intergenic
1045460400 8:102420526-102420548 AAAAATGTACAGCTAAGGCTGGG - Intergenic
1047278204 8:123421973-123421995 AAAAATACAAAACTTAGGCTGGG - Intronic
1050692358 9:8242260-8242282 AAAATTTCTCAACTGGGGCTCGG - Intergenic
1051703162 9:19846729-19846751 AGAAATGCAGATCTGGGGCTGGG + Intergenic
1052293460 9:26870910-26870932 AAAAATATAGACCTGCGGCTGGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053098428 9:35349209-35349231 AAAAAAGAAGTACTGCGGCTGGG - Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056999732 9:91496735-91496757 AAACATGCCCAACTGAGGCAGGG - Intergenic
1057245223 9:93449779-93449801 AAAAATGCATTAGTGCGGCCGGG - Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1059397092 9:114042375-114042397 AAAAATACATAACAGTGGCTGGG + Intronic
1060222448 9:121771911-121771933 AAGAAAGCACAACTGTGGCGGGG - Intronic
1060537725 9:124404550-124404572 AAAAATGCTCCAATGAGGCTGGG + Intronic
1061099664 9:128483186-128483208 AAAAATGCACAACTGCGGCTGGG - Intronic
1061122231 9:128650696-128650718 AAAAATACAAAAATGGGGCTGGG - Intronic
1187164943 X:16796296-16796318 AAAAATAAACAAGTGCGGCCGGG - Intronic
1188560436 X:31462182-31462204 ATAAAGGCACAACTCCGGCTCGG + Intronic
1192329156 X:70160153-70160175 AAAGAGGCACAACTGCTGCCCGG + Intronic
1192824455 X:74680869-74680891 AAAAATGCACAACACCTGATGGG + Intergenic
1193339352 X:80328979-80329001 AAAAAAGCACCACTGATGCTGGG + Intergenic
1193693682 X:84680457-84680479 AGAAATGCACCACTTTGGCTTGG + Intergenic
1195758349 X:108221104-108221126 AAAAATGCAGAAATGCAGCCTGG + Intronic
1196353778 X:114764101-114764123 AGAAATGTACAACTTTGGCTGGG + Intronic
1196437139 X:115684842-115684864 AAGATTGCACAACTGCAGGTAGG - Intergenic
1197370867 X:125624681-125624703 AAAAATGCAACACAGCGGCTGGG + Intergenic
1197466357 X:126808204-126808226 ATAAATGCACACCTGAGGCTGGG - Intergenic
1201906613 Y:19092182-19092204 AAAAATAAAAAACTGGGGCTGGG - Intergenic