ID: 1061099800

View in Genome Browser
Species Human (GRCh38)
Location 9:128484100-128484122
Sequence CCAATTTGATGGTAGCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061099788_1061099800 19 Left 1061099788 9:128484058-128484080 CCTATTGGCCCCACAAGTGGGGA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1061099800 9:128484100-128484122 CCAATTTGATGGTAGCGGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 41
1061099790_1061099800 11 Left 1061099790 9:128484066-128484088 CCCCACAAGTGGGGAAAGAGGAG 0: 1
1: 0
2: 1
3: 22
4: 269
Right 1061099800 9:128484100-128484122 CCAATTTGATGGTAGCGGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 41
1061099793_1061099800 9 Left 1061099793 9:128484068-128484090 CCACAAGTGGGGAAAGAGGAGGC 0: 1
1: 0
2: 4
3: 22
4: 254
Right 1061099800 9:128484100-128484122 CCAATTTGATGGTAGCGGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 41
1061099791_1061099800 10 Left 1061099791 9:128484067-128484089 CCCACAAGTGGGGAAAGAGGAGG 0: 1
1: 0
2: 2
3: 28
4: 293
Right 1061099800 9:128484100-128484122 CCAATTTGATGGTAGCGGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061099800 Original CRISPR CCAATTTGATGGTAGCGGCC TGG Intronic
903641265 1:24862000-24862022 CCAAACTGATGGCCGCGGCCAGG - Intergenic
910787106 1:91011862-91011884 CCTCTTTGATGGTAGCTTCCAGG - Intronic
920760848 1:208782453-208782475 CCAAATTGCTGGCAGAGGCCGGG + Intergenic
923509674 1:234639483-234639505 CCACTTTGATGGTATAGACCTGG - Intergenic
1062920923 10:1279163-1279185 CCAAGATGATGGTGTCGGCCAGG + Intronic
1073020781 10:100441993-100442015 CCAAATATATGGTAGAGGCCAGG + Intergenic
1074813123 10:117125194-117125216 ATTATTTGATGGTAGCTGCCTGG - Intronic
1096694064 12:53337731-53337753 CCAATTTCAGGGTAGGGCCCAGG + Intronic
1100446753 12:94668210-94668232 AAAATTTGATGGAAGAGGCCAGG + Intergenic
1103118128 12:118355378-118355400 CCAATTTGATGGAACAGCCCGGG - Intronic
1118752725 14:68818278-68818300 CCAGCTTGATGGCAGGGGCCAGG + Intergenic
1122137816 14:99644961-99644983 CAAATTCGATGGGAGTGGCCCGG - Intergenic
1124794579 15:32764544-32764566 CCTATGTGAGGGTAGAGGCCTGG - Intergenic
1130201742 15:81836317-81836339 CCTATGTGCTGGTAGCAGCCAGG + Intergenic
1147490326 17:40860055-40860077 CCAGTGTGATGTTAGAGGCCAGG + Intergenic
1148666906 17:49381857-49381879 GCAATTTGATGGCAGAGGCGGGG + Intronic
1154486429 18:14875318-14875340 CTAATTTGATGGCAGCTGCCTGG - Intergenic
1157132973 18:45024968-45024990 CCAATGTGAAGGGAGCCGCCTGG + Intronic
1159456131 18:68662019-68662041 CGAATTTGATGGTTGCGGGGGGG + Intergenic
1167189583 19:47975324-47975346 CCAATTTGATTATAGAGGCCAGG - Intronic
940527044 2:154829278-154829300 CCTACTTGAGGGTAGCGGCTGGG - Intronic
1169457812 20:5767854-5767876 CCAAGTTGCTGATAGCAGCCAGG + Intronic
1176794871 21:13364061-13364083 CTAACTTGATGGCAGCTGCCTGG + Intergenic
1181788675 22:25246158-25246180 CCAACTGGCTGGTAGAGGCCAGG - Intergenic
1182680782 22:32078061-32078083 ACAATTTGATGGTAGGGGTGGGG - Intronic
950106721 3:10393233-10393255 CCAGTGTGATGGTAGCGGGCGGG + Intronic
952071257 3:29639103-29639125 TCAATTTGAGGGAAGAGGCCTGG + Intronic
953230627 3:41062020-41062042 CCAACTTGAGGGTAGGGGGCGGG - Intergenic
953236947 3:41115275-41115297 TCAATTTGTTGGTAGCTGCCTGG - Intergenic
973603381 4:52563279-52563301 CCAATTTGAAAGTATTGGCCAGG + Intergenic
975320104 4:73000367-73000389 CCAATAAGATGGTAGAGGCGTGG + Intergenic
995335451 5:110993294-110993316 CCTATTTGAGGGTGGAGGCCGGG + Intergenic
1001227202 5:169955179-169955201 CTAACTTGATGGCAGCTGCCTGG - Intronic
1015091535 6:129364675-129364697 CAAATTTGGTGGTAGGGGCCAGG - Intronic
1018345898 6:162899209-162899231 ACAATTTGCTGGTAGTGGCCAGG + Intronic
1018918609 6:168154845-168154867 CCAGTTTGATGGTAACTGCAGGG + Intergenic
1019529960 7:1498504-1498526 CCAACTTGATGGTGGTGCCCAGG + Exonic
1022112896 7:27242278-27242300 CCAGTTTGAGGTTAGCTGCCAGG + Intergenic
1023704251 7:42924062-42924084 TAAATTTGAAAGTAGCGGCCAGG + Intronic
1025968715 7:66301455-66301477 ACTATTTGATGGAAGAGGCCTGG + Intronic
1035725051 8:1819060-1819082 CCTATTTGATGATAGAGCCCAGG + Intergenic
1048515901 8:135111424-135111446 CCATTTTGATGGTAGCCACCAGG - Intergenic
1049778325 8:144416337-144416359 CCAATTTGATGGCAGAGGGCCGG + Intronic
1051867274 9:21696300-21696322 CCCACTGGATGGTAGCTGCCAGG - Intergenic
1053887355 9:42654130-42654152 CTAACTTGATGGCAGCTGCCTGG - Intergenic
1054226377 9:62461581-62461603 CTAACTTGATGGCAGCTGCCTGG - Intergenic
1061099800 9:128484100-128484122 CCAATTTGATGGTAGCGGCCTGG + Intronic
1061168213 9:128936817-128936839 AAAATTTGGTGGTAGGGGCCGGG + Intronic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1199113060 X:143957737-143957759 CCAATTTGAGGGTAGAGGTTGGG - Intergenic