ID: 1061105274

View in Genome Browser
Species Human (GRCh38)
Location 9:128525339-128525361
Sequence CAAGAGGCACAGATGCAGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 317}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061105272_1061105274 -10 Left 1061105272 9:128525326-128525348 CCAGGTAAAGCTGCAAGAGGCAC 0: 1
1: 0
2: 0
3: 11
4: 118
Right 1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG 0: 1
1: 0
2: 1
3: 27
4: 317
1061105266_1061105274 27 Left 1061105266 9:128525289-128525311 CCTGCGAAGACAAGAGGAGGCAG 0: 1
1: 0
2: 0
3: 20
4: 175
Right 1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG 0: 1
1: 0
2: 1
3: 27
4: 317
1061105271_1061105274 -9 Left 1061105271 9:128525325-128525347 CCCAGGTAAAGCTGCAAGAGGCA 0: 1
1: 0
2: 1
3: 15
4: 175
Right 1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG 0: 1
1: 0
2: 1
3: 27
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061105274 Original CRISPR CAAGAGGCACAGATGCAGCA GGG Exonic
901819092 1:11814709-11814731 GAAGAGGCACAGATTCAGCTTGG - Intronic
901848402 1:11999327-11999349 GAAGATGCACTAATGCAGCAGGG - Intronic
902103570 1:14014192-14014214 CAACAGACACAGTTGCAACATGG - Intergenic
902203950 1:14853681-14853703 CAAGAGACACAGCTGGAGCCTGG - Intronic
902631662 1:17708271-17708293 CTAGAGGCTCAGATCCAGGAGGG - Intergenic
902825832 1:18973595-18973617 CAGGAGGCACGGAGGCAGCACGG - Intergenic
903011075 1:20330809-20330831 CAGGAGGCAAAGATGCAGAGAGG + Intronic
903582610 1:24383263-24383285 CAAGAAAAACAGATACAGCAAGG - Intronic
906471568 1:46135014-46135036 CAAGAGGCAATGATGAATCAAGG + Intronic
906763661 1:48406093-48406115 CAAGGTGCACATGTGCAGCAGGG + Intronic
907096956 1:51790752-51790774 TAAGAGGCACGGATGAAGCTAGG + Intronic
908014106 1:59814470-59814492 GAAGAGGCAGAGGGGCAGCAGGG - Intergenic
908587010 1:65580864-65580886 CCAGAGGCACAGATACCACATGG + Intronic
910116387 1:83736635-83736657 CATAAGGCATGGATGCAGCATGG - Intergenic
913136257 1:115892250-115892272 CAAGAGGAACAGGAGCATCATGG - Intergenic
914921019 1:151847579-151847601 CTAGGGACACAGATGAAGCAAGG - Intronic
914926537 1:151893613-151893635 CATCAGGCACAGATGCAGGGGGG + Intronic
915079185 1:153339929-153339951 CTAGAAGCAGAGAAGCAGCACGG + Intronic
915748688 1:158184155-158184177 CCAGAGACACAGATGTGGCAAGG - Exonic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
919784941 1:201253035-201253057 ACAGAGGCACAGATGAGGCAGGG - Intergenic
919834355 1:201563477-201563499 CAAGTGCCACAGGTACAGCAAGG + Intergenic
920089452 1:203441841-203441863 CGAGAGACAGAGATGCAGCAGGG + Intergenic
921187877 1:212685396-212685418 GAAGGGGCTCAGATGCAGCGAGG - Intergenic
922756780 1:228101311-228101333 CAAGAGGCAGATATGGACCAGGG + Intronic
924309971 1:242730929-242730951 CAATAGGCACAGAAAAAGCACGG - Intergenic
1062941472 10:1424676-1424698 TAAAAGGCACAGATGGGGCATGG + Intronic
1066503923 10:36022425-36022447 GAAAAGGCCCAGATGCAGCAAGG + Intergenic
1066656785 10:37704378-37704400 CAACAGGTACACATGCAGGAAGG - Intergenic
1067350476 10:45471346-45471368 CAAGATCCTCAGCTGCAGCATGG - Intronic
1067930659 10:50558175-50558197 GAAGAAGCACAGAGGCAGGAGGG - Intronic
1068347040 10:55794785-55794807 AATGTGGCACATATGCAGCATGG + Intergenic
1069363801 10:67674879-67674901 AAAGAGGGACATATGAAGCAGGG - Intronic
1069778605 10:70941108-70941130 AAGGAAGCACAGAGGCAGCAGGG + Intergenic
1069857600 10:71450208-71450230 CATGAGGGACAGGTGCTGCAGGG + Intronic
1069923787 10:71834066-71834088 ACAGAGGCCCAGAGGCAGCATGG + Intronic
1070732080 10:78836968-78836990 CAAATGACACAGATACAGCAGGG - Intergenic
1072295822 10:94008781-94008803 CAAGAGGCACATAAGGAGAAAGG + Intronic
1074617730 10:115087104-115087126 CAAGAGGAAGAGAGGAAGCAGGG + Intergenic
1074701151 10:116093631-116093653 CAAGAGGTACAGCTGGAGCTCGG + Intronic
1076148683 10:128145680-128145702 CAGAAGGCAGAGGTGCAGCAAGG - Intergenic
1076326528 10:129627684-129627706 CAAGAGCCAAATATGAAGCATGG - Intronic
1076369760 10:129944652-129944674 CAGCAGGCTCAGTTGCAGCAAGG - Intronic
1076445839 10:130513264-130513286 CAAGGGGCTCAGTGGCAGCAGGG - Intergenic
1076846264 10:133070995-133071017 CACCAGGCACAGATGGCGCACGG + Intronic
1076867994 10:133178648-133178670 CAGGAGGCACAGAGGCAGCCAGG - Intronic
1078048652 11:7942019-7942041 AAATAGGCACAAATGCAGAAGGG + Intergenic
1078655683 11:13236649-13236671 GAGGAGCCACAGAGGCAGCATGG + Intergenic
1080441237 11:32296635-32296657 AGAGAGACAGAGATGCAGCAAGG + Intergenic
1080614750 11:33936098-33936120 CAGGAGGCAGAGCTGCTGCAGGG - Intergenic
1081774179 11:45666139-45666161 CAAGAGGGACAACTGCAGCGGGG - Intergenic
1081876909 11:46414671-46414693 CCAGAGGCACAGCAGCAGCTTGG + Intronic
1082052677 11:47785045-47785067 CAAGTGCTACAGATGAAGCATGG - Exonic
1082753563 11:57048888-57048910 CTAGAGCCACAGATGCTGAAGGG + Intergenic
1082759320 11:57111624-57111646 CAAGAGGCACAGGTTGAGCTTGG - Intergenic
1083224407 11:61275733-61275755 CAAGGGGCACAGAGTCAGCAGGG + Intronic
1083778096 11:64903922-64903944 GAAGAACCACAAATGCAGCAGGG - Intronic
1083860098 11:65415779-65415801 CAAGGGGCACAGATAAAGCTGGG + Intergenic
1083937750 11:65879235-65879257 CAATGGGCACAGGTGCAGCTGGG + Intergenic
1083955602 11:65981369-65981391 CAAGAGCCAGAGATGCAGAGAGG - Intergenic
1084951335 11:72667536-72667558 CAAGTGGCAGAGATGAAGGATGG - Intronic
1085054246 11:73394738-73394760 AGATGGGCACAGATGCAGCAGGG + Intronic
1087166479 11:95009533-95009555 CATGAGCCCCAGATGCAGCAAGG + Intergenic
1090357789 11:126151510-126151532 AACCAGGCACAGATGCAGTAGGG + Intergenic
1091089501 11:132757158-132757180 CATGTGGCACATATGCACCATGG - Intronic
1091301818 11:134512772-134512794 GAAGAGGTACAGATGGAGGAGGG - Intergenic
1092140800 12:6182178-6182200 CACGAGTCACAGAGGCAACAGGG + Intergenic
1092950741 12:13500683-13500705 CCAAAGGCACAGAGTCAGCAGGG - Intergenic
1095154012 12:38830894-38830916 CTAGAAGCAGAGAGGCAGCATGG - Intronic
1095676626 12:44926712-44926734 CAAGAGACACAGAGGCAGATAGG - Intergenic
1095928540 12:47603653-47603675 CACCAAGTACAGATGCAGCAAGG + Intergenic
1097107198 12:56632856-56632878 GGAGAAGCACAGCTGCAGCATGG - Intronic
1097367582 12:58734883-58734905 CCAGAGTCAGAGATGCAGCCAGG + Intronic
1097441645 12:59615050-59615072 CAAGAGGCCCAAATGCTGCACGG - Intronic
1101917630 12:108908218-108908240 CAAGAGCCACAGATTCAGAGGGG + Intergenic
1102452859 12:113054736-113054758 CAACAAACACAGAGGCAGCATGG + Intergenic
1103175919 12:118862990-118863012 CAAGAGGCAGAGACGCACCAAGG - Intergenic
1105729161 13:23194303-23194325 CAAGAGGCATAAAGGCAGGATGG - Intronic
1106073791 13:26440104-26440126 AAAGAGGCAGAGATGAACCAGGG + Intergenic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1107097272 13:36550152-36550174 CAAGAAGCACAGCTGATGCAGGG - Intergenic
1107462412 13:40616845-40616867 CAAAAGGGACAGATGGAGAAAGG + Intronic
1108869986 13:54973019-54973041 CAAGAGGCACAGCTGGGCCAGGG + Intergenic
1110342526 13:74409556-74409578 CAAGAAGCCCAGAGGCAACAGGG + Intergenic
1110356826 13:74576280-74576302 TAAGAGGAACAGGTGAAGCAAGG - Intergenic
1110610314 13:77480518-77480540 GAAGAGACAAGGATGCAGCAAGG - Intergenic
1112798327 13:103082251-103082273 TAAAAGGCACAGATCCAGAAAGG + Intergenic
1113140577 13:107144355-107144377 CAAGAGGCTCAGAGGGAGCATGG + Intergenic
1113382391 13:109815847-109815869 CAAGATGCATAGATTCATCAGGG - Intergenic
1114919882 14:27312858-27312880 CAAAATGCACAAATGAAGCAAGG - Intergenic
1115057904 14:29153037-29153059 CAAGAGGTACAGATGAGGAAAGG + Intergenic
1117098790 14:52324240-52324262 CAGGAGGCAGAGAGGCAGGAGGG + Intronic
1117100214 14:52338253-52338275 CAACCTGCACAGATGCAACAAGG + Intergenic
1117421124 14:55546645-55546667 CAAGAGGAACCGATACAGAAGGG + Intergenic
1118038323 14:61892101-61892123 GAAGGGGCAGAGATGCAGAAAGG - Intergenic
1119032009 14:71200142-71200164 CAAGATGCACAGATGCAGTAAGG + Intergenic
1120762357 14:88296531-88296553 AAAGAGAAACAGCTGCAGCATGG - Intronic
1120894138 14:89514736-89514758 CAAGATGCACAGATGGAGTGAGG - Intronic
1121560727 14:94873541-94873563 CAAGTGGCAGAGATGCTGGAAGG - Intergenic
1122874577 14:104657941-104657963 CAGGAGACACAGATCTAGCAAGG + Intergenic
1124384485 15:29195165-29195187 CCAGAGTGACAGATGCAGCGGGG - Intronic
1124823363 15:33069260-33069282 CAAGAGGCAGCTATGCAGCTAGG - Intronic
1127405609 15:58641916-58641938 CAAGAGGCTCAGAAGCAGGGAGG + Intronic
1130162565 15:81415664-81415686 CAAGAGCAACAGGTGCAACATGG - Intergenic
1132615753 16:840462-840484 CCAGAAGCAGAGCTGCAGCAAGG - Intergenic
1134072833 16:11271561-11271583 TTAGAGGGACAGCTGCAGCAGGG + Intronic
1134182735 16:12060948-12060970 CGAGGGGCTCAGATGCAGCGAGG + Intronic
1134271231 16:12735026-12735048 CAACAGGCAGAGAAGCAGCCGGG + Intronic
1134551888 16:15142397-15142419 CAAGGCCCACAAATGCAGCAAGG + Intergenic
1134865904 16:17606877-17606899 AAGGAGGCACAGATTCAGAAAGG + Intergenic
1136065452 16:27755323-27755345 CAGAAGGCAGAGATGGAGCAGGG - Intronic
1136280949 16:29210924-29210946 CAACCAGAACAGATGCAGCACGG + Intergenic
1138104889 16:54282626-54282648 CAAGACGCACAGATGCTCCCAGG + Intergenic
1140623361 16:76763252-76763274 AAAGAGCCTCAGATACAGCATGG + Intergenic
1140736140 16:77899442-77899464 CAAGGGTTACAGATGCAGAAAGG - Intronic
1140895010 16:79317192-79317214 AAAGAGGGACAGATGAAGGAAGG - Intergenic
1141280017 16:82622940-82622962 CAAAGGGCACAGATGCAGGTTGG + Intergenic
1141630653 16:85286105-85286127 CAAGAGGCACACATGCGCCCTGG - Intergenic
1142085307 16:88176847-88176869 CAACCAGAACAGATGCAGCACGG + Intergenic
1142492206 17:286410-286432 CCAGAGACACTGAAGCAGCAGGG - Intronic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1143385553 17:6527992-6528014 CAAAAGCCAAAGATGGAGCAGGG - Intronic
1143790035 17:9287427-9287449 CAACAGGCACAGAAGAAGAAAGG + Intronic
1144281033 17:13726674-13726696 CAATAGGCAGAGCAGCAGCATGG + Intergenic
1147327358 17:39675878-39675900 CAAGAGGAGCAGAAGCAGCAAGG - Intronic
1147389202 17:40099135-40099157 CGAGAGGCACACGTGGAGCAGGG - Intronic
1151059650 17:71077304-71077326 GAATGGGCACAGATGCAGAAAGG - Intergenic
1151393451 17:73803419-73803441 CAAGAGGCACAGGAGTAGCCTGG - Intergenic
1151607531 17:75148459-75148481 CAACAGCCACAGATGCAGCTTGG - Intronic
1156160295 18:34350944-34350966 CAGGAGGGGCAGAGGCAGCAGGG - Intergenic
1157170830 18:45403579-45403601 GCAGTGGCACAGATGGAGCATGG + Intronic
1157429788 18:47615266-47615288 CCTGAGGCACAGAGGGAGCAAGG + Intergenic
1160394129 18:78559499-78559521 CCAGAGTCTCAGAAGCAGCATGG - Intergenic
1161662524 19:5555731-5555753 CAAAAGCCACAGAAGCTGCAGGG - Intergenic
1162496071 19:11024031-11024053 CAAGAGGGACAACTGCAGCCGGG - Intronic
1164767214 19:30781256-30781278 CAGGAGGCAGAAATGCAGGATGG + Intergenic
1165483596 19:36081709-36081731 CAAGAGGCAGTGATGCAGAGAGG - Intronic
1166488194 19:43232576-43232598 CAAAAGGCACAGCTGGAGGATGG - Intronic
1166494861 19:43293056-43293078 CAAAAGGCACAGCTGGAGGATGG - Intergenic
1166866172 19:45838745-45838767 CCAGAGGCAGAGCTGCAGCCTGG - Intronic
1167292010 19:48629699-48629721 CTACAGGCACAGATGCACCCTGG + Exonic
1167675105 19:50878984-50879006 CATGAGGCACACACACAGCAAGG + Exonic
1167978852 19:53255509-53255531 CAGGAGGCAGAGATGCACCATGG + Intergenic
925118119 2:1397654-1397676 CAAGGACCAGAGATGCAGCAGGG - Intronic
925770466 2:7277476-7277498 CAAAAGGCACAAATGCAGAGTGG - Intergenic
926393936 2:12422577-12422599 AATGTGGCACATATGCAGCATGG - Intergenic
927813169 2:26191681-26191703 CCAGAGCCGCAGATGCAGAATGG + Intronic
928410131 2:31048306-31048328 CAAAAGCCACAGAGCCAGCAGGG - Intronic
929138376 2:38646081-38646103 CAACAGGAACAGAAGAAGCAGGG - Intergenic
930191879 2:48467955-48467977 CATGATGCACAGAAGAAGCAGGG - Intronic
931056594 2:58479277-58479299 CACAAGGCACAGATGCATCAAGG + Intergenic
931218695 2:60269729-60269751 CAAGGGGCACACAGGCAGCCAGG + Intergenic
932163593 2:69485591-69485613 CAAAAGGCATAGATGTGGCAGGG - Intronic
932402157 2:71488486-71488508 CAGGGGGCCCAGATGCAACAAGG + Intronic
932403704 2:71499950-71499972 CCAGAGGCTCAGATGAGGCAAGG - Intronic
932851605 2:75192985-75193007 AAAGAGGAAGAGAGGCAGCAAGG - Intronic
936432935 2:112480744-112480766 CAGGAGGAATTGATGCAGCATGG + Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
940789850 2:158020575-158020597 GAAGAAGGACAGATGCAACATGG + Intronic
941093063 2:161200856-161200878 CCAGAGGCAGAGCAGCAGCATGG + Intronic
942062036 2:172236252-172236274 CAAGAGGCACACATGTACCAAGG - Intergenic
942877590 2:180820063-180820085 CAAGAAGTACAGATGAAGTATGG - Intergenic
944765297 2:202858253-202858275 AATGAGGCACATATGCATCAAGG + Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
945590287 2:211720571-211720593 AAACAGGCAAAGATCCAGCACGG - Intronic
946342269 2:219078094-219078116 CAAGTGGGACAGAAGCATCAAGG - Exonic
946387772 2:219395658-219395680 CAAGAGAAAGAGATGCACCAAGG - Intronic
946820131 2:223620585-223620607 CAAGAGGCAGAGATGGGGAAGGG - Intergenic
947574341 2:231260781-231260803 CAAGAGGCTCAGGAGTAGCACGG - Intronic
948124423 2:235554486-235554508 CAGCAGGCCCACATGCAGCAGGG - Intronic
1168994901 20:2125801-2125823 CAGGAGCCACATATGCAGCCAGG + Intronic
1170519538 20:17169688-17169710 GGAGAGGCTCACATGCAGCATGG - Intergenic
1172013953 20:31862069-31862091 CCAGAGGCTCATCTGCAGCACGG - Intronic
1173033964 20:39390708-39390730 CCAGGAGCACAGAGGCAGCATGG - Intergenic
1173491268 20:43484328-43484350 CAAGAGGCAAAGATGGACCAGGG + Intergenic
1175424176 20:58853822-58853844 CAGGAGGCCCAGGTGCTGCAGGG + Exonic
1175818576 20:61896362-61896384 CAGGAGGCCCAGATGCGGGACGG - Intronic
1177529688 21:22343184-22343206 CCATAGGCAGAGAAGCAGCATGG + Intergenic
1179345334 21:40550843-40550865 CGAGAGGCACAGAAACAGCAGGG + Intronic
1180978814 22:19869011-19869033 CAGGAGGCCCAGACACAGCAGGG - Intergenic
1182506090 22:30783779-30783801 GAAGAGGCACATTTGCATCAAGG - Intronic
1182674997 22:32032231-32032253 CAAGAGTCAAAGAAACAGCATGG - Intergenic
1182711782 22:32327796-32327818 CCACGGACACAGATGCAGCAAGG + Intergenic
1184643297 22:45883373-45883395 CCAGAGGCACCGTTGCAGCCAGG - Intergenic
1185003297 22:48259854-48259876 CCAGAGGCCCAAAGGCAGCACGG + Intergenic
1185174919 22:49321079-49321101 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185174934 22:49321135-49321157 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
1185174949 22:49321191-49321213 CAGGAGGGACAGAGGCAGCGTGG - Intergenic
949949557 3:9217870-9217892 CAAGAGTCACAGAGGCAGGGAGG + Intronic
950380121 3:12606064-12606086 CAAGTTCCACAGAAGCAGCAAGG + Intronic
951988712 3:28651245-28651267 AGAGAGGCACAGATGAAACATGG - Intergenic
952492072 3:33882479-33882501 CCAGAGGCACGGATACAACAGGG + Intergenic
952691731 3:36215006-36215028 GAAAAGGCACAGATACAGAAGGG - Intergenic
953170565 3:40503053-40503075 CAAGACACACACATGGAGCAGGG - Intergenic
954805849 3:53220018-53220040 CAGGAGGCACTGCTGCAGCCAGG + Intergenic
955446564 3:59017309-59017331 CAAGGGGCAGTGATGCAGCTGGG - Intronic
956673947 3:71717130-71717152 TGAGTGGCAAAGATGCAGCAGGG - Intronic
956750985 3:72343837-72343859 CAAGAGGGACAGAGGCAAGAGGG - Intergenic
956969701 3:74508262-74508284 CAGAAGGCAAAGAAGCAGCAAGG - Intronic
956986196 3:74703450-74703472 TAAGAGGCACATATACACCATGG + Intergenic
957214248 3:77298759-77298781 CAGGAGGCACAGATGAATGAAGG - Intronic
957699572 3:83691058-83691080 GAAGTGGCACATATGCACCATGG + Intergenic
960241746 3:115350649-115350671 CAAGAGGCAGAGATCCTGCTAGG + Intergenic
960951850 3:123004316-123004338 CAAGAGGCACAGCTGGAAAAAGG + Intronic
961434372 3:126906463-126906485 CACGAGGCACAGATGCAGGGAGG - Intronic
961794598 3:129400756-129400778 GAATAGCCACAGATGCAGCAGGG - Intergenic
962139452 3:132772974-132772996 CAAGAGTCCCAGGTGAAGCAGGG - Intergenic
962153526 3:132918621-132918643 CCATAGGGACAGATGCAGGAAGG + Intergenic
963688750 3:148471951-148471973 GAAAAGGCACTGATGCAACAGGG + Intergenic
963976826 3:151489604-151489626 AATGAGGCACATATGCACCATGG + Intergenic
964101823 3:152996382-152996404 AGAGTGGCACAGATACAGCAGGG + Intergenic
965712366 3:171568282-171568304 CCAGAGACACAGAAGAAGCATGG + Intergenic
968280313 3:197472120-197472142 CAGGAGGCCCAAATTCAGCAAGG + Intergenic
968940836 4:3636780-3636802 CAAGAGGAAGAGGTGCAGCAGGG - Intergenic
969353307 4:6610768-6610790 CCATAGGCACAGCAGCAGCATGG - Intronic
970914063 4:21311784-21311806 CAAGATGAACAGATGCAGTGAGG + Intronic
970963859 4:21905250-21905272 TAAGAGACACAGACACAGCATGG - Intronic
972128411 4:35800427-35800449 AAAGAGGCACACCTGCACCAGGG + Intergenic
972336046 4:38107871-38107893 CAAGAAACACAGAAGCAACATGG - Intronic
975075550 4:70203833-70203855 AAAGAGGCTCACAGGCAGCAGGG - Intronic
975892492 4:79046340-79046362 CAGCAGGCACAGAAGCAGAAGGG - Intergenic
976437252 4:85032441-85032463 CAAAATGCACAAATGAAGCAAGG + Intergenic
976931490 4:90571362-90571384 CATGTGGCACAGATACACCATGG + Intronic
980164395 4:129207909-129207931 TAAGAGACACAGAAGCAGAAGGG + Intergenic
980730572 4:136818978-136819000 CAGGAAGCAAAGAGGCAGCATGG - Intergenic
981696633 4:147565300-147565322 CAAAACGCACAAATGAAGCATGG + Intergenic
983496597 4:168449248-168449270 TAAGAGGCACATATACACCATGG + Intronic
985614919 5:914307-914329 CAAGATGCACAGCTGCACTAGGG - Intronic
985795911 5:1962015-1962037 CAGGACGCAGAGGTGCAGCAGGG - Intergenic
986168585 5:5296934-5296956 GAAGGGGCACAGAAGCGGCAAGG + Intronic
989076470 5:37568764-37568786 CAAGGGGCACAGATACAGGAGGG - Intronic
990115034 5:52379556-52379578 AATGAGGCACATATACAGCATGG - Intergenic
990307730 5:54509527-54509549 CAAGAGACACAGCTGCTCCAGGG + Intergenic
990973180 5:61532247-61532269 CATTAGGCACAGATTCATCAAGG + Intronic
991966697 5:72098798-72098820 CAACAGGCAGAGATGGAGAAAGG - Intergenic
992796718 5:80260117-80260139 CCATAGGCAGAGCTGCAGCATGG - Intergenic
993197939 5:84774518-84774540 CAAGAGGAACAGTTAGAGCAGGG + Intergenic
994536920 5:101043024-101043046 CAAGAGGCACAGACAGAGCTGGG - Intergenic
994747495 5:103696890-103696912 CAAGAGGCAAAGATGAAGTGGGG - Intergenic
996671323 5:126121411-126121433 TAAGAGGCACAGGTGGATCAAGG - Intergenic
996675298 5:126168140-126168162 CAAGTGGCAGGGAAGCAGCATGG - Intergenic
996937824 5:128968119-128968141 AATGAGGCACATATGCACCATGG - Intronic
997192859 5:131955342-131955364 AAAGAAGCACAGATTCAGTAAGG + Intronic
997526411 5:134555875-134555897 CAAGAGGCCCACATGAAGGAAGG - Intronic
998104622 5:139460582-139460604 CAAGAGGCAAAGAAAGAGCAGGG - Intronic
998506090 5:142674058-142674080 CACCAGGCACACATGAAGCAGGG - Intronic
999690287 5:154140546-154140568 CCAGAGGCAGAGATGGAGCTAGG - Intronic
1000965053 5:167646611-167646633 CAAGAGACACAAATTCAGCTAGG + Intronic
1001085652 5:168698517-168698539 CTAGAGGCTCAGAGGGAGCATGG + Intronic
1002620757 5:180486497-180486519 AAAGAGGAATAGAAGCAGCAAGG - Intergenic
1004513916 6:16306018-16306040 CTAGCGGCACAGAAGCAGCCGGG - Exonic
1004859112 6:19782935-19782957 CATGTGCCACAGATGCAGCCGGG - Intergenic
1005087567 6:22022541-22022563 AAAGAGGCAGAGAAGCAGGAAGG - Intergenic
1005301652 6:24476882-24476904 CAAGAGCCACAAATGCCTCATGG + Intronic
1006681277 6:35798314-35798336 CATGAGCCTCAGATGGAGCAGGG + Intergenic
1007065493 6:38986804-38986826 CAAGAGGAAGGGCTGCAGCAGGG + Intronic
1007825006 6:44593886-44593908 CAGGAAGAACAGATGCAGCCAGG + Intergenic
1009950994 6:70395397-70395419 CAATAGGCACACATGAGGCAGGG - Intergenic
1009985912 6:70780768-70780790 GAAGAGACACAGAGACAGCATGG - Intronic
1012734729 6:102924782-102924804 TAAGGGGCACAGATGCTCCATGG + Intergenic
1013308563 6:108872461-108872483 CAAGAGGGATGGAGGCAGCATGG - Intronic
1015748474 6:136536104-136536126 TAAGAGGCACATATACACCACGG - Intronic
1017552147 6:155520477-155520499 CAAGAGTTAGAGAAGCAGCAGGG - Intergenic
1018117432 6:160600978-160601000 CACGATGCTCAGATGCAGAATGG - Exonic
1018510517 6:164519886-164519908 AAAGGGGCACTGATGCAGCTTGG + Intergenic
1019267665 7:127458-127480 CAACATCCACAGATTCAGCAGGG - Intergenic
1019805122 7:3117932-3117954 CAAAAGGGACAAATGCAGGAGGG - Intergenic
1020601163 7:10275980-10276002 CATGTGGCACATATGCACCATGG + Intergenic
1020630889 7:10637957-10637979 CAAGAGGAACAGAGGCAGGCAGG + Intergenic
1021338982 7:19439784-19439806 CAAAAGGCAAAGAGGAAGCAGGG - Intergenic
1022535963 7:31098680-31098702 CATTATGCACAGATGCAGCGGGG + Intronic
1022749221 7:33205652-33205674 AAAGAGGCAGTGAAGCAGCAAGG + Intronic
1023066554 7:36383446-36383468 AATGTGGCACATATGCAGCATGG + Intronic
1026621032 7:71950106-71950128 CAAAATGCACAAATGAAGCAAGG - Intronic
1027846974 7:83392554-83392576 CAACAGGCACACATGCAAAAAGG - Exonic
1029347054 7:99986328-99986350 TAAGAGGCAGAGCTGCAGCCAGG + Intergenic
1029933094 7:104394288-104394310 CCAGAGGCACAGATGCAACCTGG - Intronic
1030649088 7:112097467-112097489 CAAGAGGCTGAGAGGCAGGAGGG + Intronic
1030864890 7:114688856-114688878 CAAGAGGAAAACCTGCAGCAAGG - Intronic
1031205486 7:118751819-118751841 GCAGAGGAACAGATGCAGGAGGG - Intergenic
1032673519 7:134107275-134107297 CAAGACGCACAGACAAAGCAAGG + Intergenic
1033097021 7:138441090-138441112 CTGGAGGCCAAGATGCAGCATGG + Intergenic
1033203645 7:139396802-139396824 CAAGAGTAACAGTTACAGCATGG - Intronic
1033653413 7:143358784-143358806 CAAGAGACACATTTGCAGGATGG - Intronic
1034100540 7:148446238-148446260 CACCAGGCACTGCTGCAGCATGG - Intergenic
1035322741 7:158044215-158044237 TAAGTGGCACAGAGGCAGGAGGG + Intronic
1036289127 8:7471827-7471849 GAAAAGGAACAGATGCAACAGGG - Intronic
1036332348 8:7839700-7839722 GAAAAGGAACAGATGCAACAGGG + Intronic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1039475841 8:37839029-37839051 GAAGAGGCAGAGCAGCAGCAAGG - Exonic
1039641964 8:39233206-39233228 CAACAGGCAAAGCAGCAGCATGG + Intronic
1040285847 8:46099998-46100020 CAAGAGACACAGAGGCACCCTGG - Intergenic
1040367307 8:46731172-46731194 AATGTGGCACAGATACAGCATGG + Intergenic
1040692630 8:49958245-49958267 CACAAGGCACACATCCAGCAGGG + Intronic
1041424356 8:57703486-57703508 CCAAGGGCACAGAGGCAGCAGGG + Intergenic
1042838700 8:73101902-73101924 CAAGAGTCACAGAGGATGCAGGG + Intronic
1043533650 8:81176582-81176604 AAAGGGGCACAGATACAGCTGGG - Intergenic
1043626757 8:82271396-82271418 TAAGAGGCACAGGTGAAGCAAGG + Intergenic
1044308758 8:90667470-90667492 CATGAGGCACATAAGCACCAAGG + Intronic
1044614830 8:94129252-94129274 GAAAAGGCACAGAGGCAGAAGGG + Intronic
1045246123 8:100443081-100443103 CAAGAGGCACTGATGCTGAAAGG - Intergenic
1048019204 8:130522919-130522941 CAAGAGGGACAGTTGCAGTGGGG + Intergenic
1048321244 8:133401873-133401895 CAAAAGGCATGGATGCAGGAGGG + Intergenic
1049211067 8:141386652-141386674 CAAGAGGCAGAGCCGCAGCCGGG - Intergenic
1050267547 9:3906655-3906677 CCTGAGGCAGAAATGCAGCAAGG - Intronic
1050272758 9:3963399-3963421 CAAGCGGCACATCTCCAGCAGGG - Intronic
1051243708 9:15086849-15086871 CTTGAGGAACAGATGTAGCAAGG - Intergenic
1051255309 9:15207068-15207090 CAGGAGGCAAAGAGGAAGCAAGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053119968 9:35539061-35539083 CAAAAGGGACAGACGCATCAGGG + Exonic
1053382632 9:37661233-37661255 CTAGAGTCACAGAGGCAGGAGGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053562929 9:39214830-39214852 CCAGAGGCAGAGCAGCAGCATGG + Intronic
1053828723 9:42052776-42052798 CCAGAGGCAGAGCAGCAGCATGG + Intronic
1054134219 9:61404225-61404247 CCAGAGGCAGAGCAGCAGCATGG - Intergenic
1054601836 9:67134678-67134700 CCAGAGGCAGAGCAGCAGCATGG - Intergenic
1055180094 9:73376828-73376850 CAAAAGGCACAGGGGGAGCAGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057227877 9:93302042-93302064 CCAGGGGCACAGAGGCAGGAGGG - Intronic
1057624266 9:96663694-96663716 CCAGAGGCAGAGATGCAGCCAGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058074429 9:100636567-100636589 CAACAGGCACATATACACCATGG - Intergenic
1058091171 9:100807336-100807358 AAAGAGGAAGAGAGGCAGCAAGG + Intergenic
1058169130 9:101657871-101657893 AAAGAGACACAGATGCAGGCAGG - Intronic
1058555327 9:106160525-106160547 GAAGAGGAACAGATGGAGCAGGG + Intergenic
1060237582 9:121876765-121876787 CAGGAGGCACTGATGCTGCTGGG - Intronic
1060510072 9:124225200-124225222 AGGGAGGCACAGATGCAGAAAGG + Intergenic
1060960792 9:127679130-127679152 CAAGAGGCACATGTGCACTAAGG - Intronic
1061105274 9:128525339-128525361 CAAGAGGCACAGATGCAGCAGGG + Exonic
1061297973 9:129687260-129687282 CAACATGCACAGATGCTTCATGG + Intronic
1061401982 9:130373465-130373487 CAAGAAGCTCAGATGCCACAAGG - Intronic
1186404067 X:9286274-9286296 CAAGAGGGAAAGAGCCAGCATGG + Intergenic
1186635846 X:11403966-11403988 AAAAAGACACAGATGCAGAAAGG + Intronic
1189977514 X:46477485-46477507 CAAGAGGAACAGATCCAGAAGGG + Intronic
1190279534 X:48920227-48920249 GAAGATGCACAGATGCTCCAGGG + Intergenic
1190482258 X:50889400-50889422 CCAGAGGTGCAGCTGCAGCATGG + Intergenic
1191985064 X:66970698-66970720 AATGAGGCACATATGCACCATGG - Intergenic
1193412689 X:81183465-81183487 AAAGGGGCCCAGATGCAGCTTGG + Intronic
1195986484 X:110636215-110636237 CTAAAGGCAGAGATGCTGCAGGG + Intergenic
1198507877 X:137319097-137319119 CAAGGGGCAGAGATGCATCCAGG - Intergenic
1199167221 X:144691109-144691131 CATGTGGCACATATGCACCATGG - Intergenic
1201529034 Y:14971504-14971526 AATGTGGCACATATGCAGCATGG - Intergenic
1201580642 Y:15508547-15508569 AAAGTGGCACATATACAGCATGG + Intergenic
1201945352 Y:19504595-19504617 CAAGAAGCCCTGATGCAGGAGGG + Intergenic
1202067942 Y:20960216-20960238 CCAGAGGCACAGGTGCCACAGGG + Intergenic