ID: 1061108863

View in Genome Browser
Species Human (GRCh38)
Location 9:128552752-128552774
Sequence GAGCTGCCCAGCTCCCACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 402}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061108863_1061108876 17 Left 1061108863 9:128552752-128552774 CCCGGGTGGGAGCTGGGCAGCTC 0: 1
1: 0
2: 1
3: 55
4: 402
Right 1061108876 9:128552792-128552814 CGGCGCGCGGACAGGTGAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 102
1061108863_1061108871 -7 Left 1061108863 9:128552752-128552774 CCCGGGTGGGAGCTGGGCAGCTC 0: 1
1: 0
2: 1
3: 55
4: 402
Right 1061108871 9:128552768-128552790 GCAGCTCTTCAGGCGGGGCGGGG 0: 1
1: 0
2: 1
3: 18
4: 211
1061108863_1061108869 -9 Left 1061108863 9:128552752-128552774 CCCGGGTGGGAGCTGGGCAGCTC 0: 1
1: 0
2: 1
3: 55
4: 402
Right 1061108869 9:128552766-128552788 GGGCAGCTCTTCAGGCGGGGCGG 0: 1
1: 0
2: 0
3: 21
4: 214
1061108863_1061108877 18 Left 1061108863 9:128552752-128552774 CCCGGGTGGGAGCTGGGCAGCTC 0: 1
1: 0
2: 1
3: 55
4: 402
Right 1061108877 9:128552793-128552815 GGCGCGCGGACAGGTGAGCCGGG 0: 1
1: 0
2: 0
3: 12
4: 157
1061108863_1061108881 29 Left 1061108863 9:128552752-128552774 CCCGGGTGGGAGCTGGGCAGCTC 0: 1
1: 0
2: 1
3: 55
4: 402
Right 1061108881 9:128552804-128552826 AGGTGAGCCGGGCGGGCCGCGGG 0: 1
1: 3
2: 0
3: 39
4: 280
1061108863_1061108882 30 Left 1061108863 9:128552752-128552774 CCCGGGTGGGAGCTGGGCAGCTC 0: 1
1: 0
2: 1
3: 55
4: 402
Right 1061108882 9:128552805-128552827 GGTGAGCCGGGCGGGCCGCGGGG 0: 1
1: 1
2: 2
3: 55
4: 475
1061108863_1061108879 22 Left 1061108863 9:128552752-128552774 CCCGGGTGGGAGCTGGGCAGCTC 0: 1
1: 0
2: 1
3: 55
4: 402
Right 1061108879 9:128552797-128552819 CGCGGACAGGTGAGCCGGGCGGG 0: 1
1: 0
2: 2
3: 17
4: 179
1061108863_1061108873 4 Left 1061108863 9:128552752-128552774 CCCGGGTGGGAGCTGGGCAGCTC 0: 1
1: 0
2: 1
3: 55
4: 402
Right 1061108873 9:128552779-128552801 GGCGGGGCGGGGCCGGCGCGCGG 0: 2
1: 10
2: 105
3: 498
4: 2296
1061108863_1061108874 9 Left 1061108863 9:128552752-128552774 CCCGGGTGGGAGCTGGGCAGCTC 0: 1
1: 0
2: 1
3: 55
4: 402
Right 1061108874 9:128552784-128552806 GGCGGGGCCGGCGCGCGGACAGG 0: 1
1: 2
2: 8
3: 100
4: 702
1061108863_1061108872 -3 Left 1061108863 9:128552752-128552774 CCCGGGTGGGAGCTGGGCAGCTC 0: 1
1: 0
2: 1
3: 55
4: 402
Right 1061108872 9:128552772-128552794 CTCTTCAGGCGGGGCGGGGCCGG 0: 1
1: 0
2: 5
3: 47
4: 278
1061108863_1061108878 21 Left 1061108863 9:128552752-128552774 CCCGGGTGGGAGCTGGGCAGCTC 0: 1
1: 0
2: 1
3: 55
4: 402
Right 1061108878 9:128552796-128552818 GCGCGGACAGGTGAGCCGGGCGG 0: 1
1: 0
2: 1
3: 10
4: 179
1061108863_1061108870 -8 Left 1061108863 9:128552752-128552774 CCCGGGTGGGAGCTGGGCAGCTC 0: 1
1: 0
2: 1
3: 55
4: 402
Right 1061108870 9:128552767-128552789 GGCAGCTCTTCAGGCGGGGCGGG 0: 1
1: 0
2: 2
3: 25
4: 211
1061108863_1061108880 28 Left 1061108863 9:128552752-128552774 CCCGGGTGGGAGCTGGGCAGCTC 0: 1
1: 0
2: 1
3: 55
4: 402
Right 1061108880 9:128552803-128552825 CAGGTGAGCCGGGCGGGCCGCGG 0: 1
1: 3
2: 7
3: 50
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061108863 Original CRISPR GAGCTGCCCAGCTCCCACCC GGG (reversed) Intronic
900120212 1:1045627-1045649 GCTCTGCCCAGCCCCCAGCCAGG - Intronic
900146021 1:1158935-1158957 GAGCTGGCCAGTCCCTACCCAGG - Intergenic
900176868 1:1294924-1294946 GACAGGACCAGCTCCCACCCAGG + Intronic
900397869 1:2460641-2460663 GAGCAGCCCAGCTTACACCTGGG - Intronic
900415029 1:2530887-2530909 GAGCTGCCCGGAGCCCAGCCAGG - Intergenic
900457779 1:2785792-2785814 GAGCTGCCCACCTGCCCCCAGGG - Intronic
900516620 1:3085233-3085255 GACCCTCCCAGCACCCACCCAGG - Intronic
901090445 1:6637399-6637421 GAGACCCCCAGCGCCCACCCTGG + Intronic
901510651 1:9716672-9716694 CAGCTCCCCGACTCCCACCCAGG - Intronic
902371863 1:16012621-16012643 CAGCTTCCCTCCTCCCACCCTGG - Intergenic
903377661 1:22876714-22876736 CTGCTGCCCACCGCCCACCCTGG - Intronic
903778940 1:25809633-25809655 GAGCTGCCCACCTTCTCCCCAGG - Intronic
903894292 1:26593331-26593353 GACCTGCTCAGTTCCCAACCTGG + Intergenic
903986830 1:27234831-27234853 GAGCCCCCCAGCCCCCTCCCCGG + Exonic
904391834 1:30191079-30191101 GTGAGGCCCAGCTCTCACCCGGG - Intergenic
905790776 1:40788101-40788123 GAGCCCCCGACCTCCCACCCCGG + Intronic
906211759 1:44016142-44016164 GAGCTGGCCAGGGTCCACCCAGG - Intronic
907046527 1:51303238-51303260 CAGCTGTCCAGCTGCCTCCCAGG - Intronic
907390244 1:54153329-54153351 GGGCTGTTCAGCTCCGACCCAGG + Exonic
907430271 1:54407021-54407043 GAGCCGCCCAGCTCTCAGCGTGG - Intronic
908460841 1:64347204-64347226 CATCTGCCCAGTTCCTACCCAGG - Intergenic
908822488 1:68102765-68102787 GACCTTCCCAGACCCCACCCAGG + Intronic
912409078 1:109467203-109467225 CACCTCCCCAGCCCCCACCCTGG - Intronic
915594457 1:156888202-156888224 TAGCTGCCCACCTTCCAGCCTGG - Intergenic
915678258 1:157552284-157552306 AAGCTGTCCCGATCCCACCCAGG + Intronic
915840412 1:159208466-159208488 GAGCTGCCAAGCTATTACCCAGG - Intergenic
916349230 1:163829998-163830020 GAGCTGCCTGGCTCCATCCCAGG - Intergenic
920078230 1:203352521-203352543 GAGCCTCCCTGCTTCCACCCTGG - Intergenic
920110062 1:203581544-203581566 GAACTGCCCATCACCCACCCTGG + Intergenic
921390282 1:214608214-214608236 GAGCCGCCCACCTTCCTCCCAGG + Intronic
922478308 1:225921954-225921976 GAGCTGCCCATCCTCCACCAGGG + Exonic
922586168 1:226736579-226736601 GAGCTGCCTAGCTCCCTCATTGG - Exonic
923686303 1:236155893-236155915 CAGGAGCTCAGCTCCCACCCAGG - Intronic
1063299679 10:4840427-4840449 GAGCCCCTCAGCTCCCTCCCTGG + Intronic
1063958695 10:11288268-11288290 GGAGAGCCCAGCTCCCACCCAGG + Intronic
1064720196 10:18221024-18221046 GAACTGCCCAGCCCCCATCCAGG - Intronic
1067065198 10:43100569-43100591 GAGGTGCCCAGCTTCCGCCTGGG + Exonic
1069509939 10:69034721-69034743 CTGCTGCTCAGCTACCACCCTGG + Intergenic
1069750228 10:70740820-70740842 GAGCTCCACAGCCCCCACCCTGG + Intronic
1069768731 10:70883872-70883894 GGGCTCCTCAGCTCCCTCCCTGG + Exonic
1069833719 10:71296010-71296032 GGGAAGCCCAGCTCCCTCCCGGG + Intronic
1069876984 10:71569038-71569060 GAGCTTCCCCGCTCCAGCCCTGG + Intronic
1070592410 10:77810503-77810525 GAGCTGCACAGCGTCCAGCCTGG - Intronic
1071134594 10:82438440-82438462 GTGCTGCCCTTCCCCCACCCAGG + Intronic
1071549521 10:86555959-86555981 GAGCAGATCAGCTGCCACCCAGG - Intergenic
1072566378 10:96620142-96620164 AAGCTACCCAGCTCTCAGCCAGG + Intronic
1073025491 10:100484314-100484336 GAGCTGCCCAGCCCCAGACCTGG - Intergenic
1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG + Intronic
1075096870 10:119477736-119477758 AACCTGCCCAGCTCCCTCTCTGG - Intergenic
1075216424 10:120540201-120540223 CAGCTGCCCAGCTCTCCCCAGGG + Intronic
1075439113 10:122465432-122465454 TAGCTGCCCAGCTGTAACCCAGG - Intronic
1076063278 10:127429692-127429714 GGGCTGCAGAGCTCCCATCCAGG - Intronic
1076215984 10:128693676-128693698 GACCTGCCCAGCCCCCATGCAGG + Intergenic
1076407466 10:130222205-130222227 GAGCAGTCCTGCTGCCACCCGGG + Intergenic
1076821779 10:132943237-132943259 GGGCTCCCCACCTCCCAGCCGGG + Intergenic
1076840475 10:133042775-133042797 GAGCAGCCCACCTGCCCCCCAGG - Intergenic
1076871555 10:133197366-133197388 CGGCGGCCCAGCACCCACCCCGG + Intronic
1076890288 10:133280082-133280104 GAGCAGCCCTGCTCCTACCATGG + Intronic
1077184776 11:1231160-1231182 GGGATGCCAGGCTCCCACCCCGG + Intronic
1077356895 11:2122837-2122859 GCTCTTCCCAGCTCCCACACAGG - Intergenic
1077413025 11:2412253-2412275 GGACTGCCCACCTCCCTCCCAGG - Exonic
1077504524 11:2923939-2923961 GAGCTGGCCAGGCCCCACCTGGG - Intronic
1079103125 11:17553632-17553654 TCGCCCCCCAGCTCCCACCCAGG + Intronic
1079796299 11:24807220-24807242 GATCTGCCCACCTCCCACCTTGG - Intronic
1080215576 11:29836345-29836367 GAGCTATCCTGCTGCCACCCAGG - Intergenic
1081738697 11:45423208-45423230 ATGCTGCCCAGCCCCCACCAAGG - Intergenic
1081887698 11:46512988-46513010 GAGCTGCAAAACTCCCACACTGG + Intronic
1083041231 11:59689232-59689254 GGGCTGCCCCGCTCCCTACCAGG - Intergenic
1083221960 11:61258602-61258624 GAGCTGCCCTGCACACACCCTGG + Exonic
1083622704 11:64056885-64056907 GTGCAGACCAGCTCCGACCCTGG - Intronic
1083661599 11:64254049-64254071 GAGGTCCCCAGCCCCCATCCTGG - Intronic
1083661860 11:64255166-64255188 GGGCTGCCCAGCCACAACCCAGG - Intronic
1083663663 11:64263604-64263626 GTGCTGCCCAGAGCCCACCAAGG - Intronic
1083765675 11:64840376-64840398 GGGCTGGCCAGTTCCCAGCCAGG + Intronic
1083800945 11:65045952-65045974 CAGCAGCCCAGCTACCAGCCTGG + Intronic
1083942376 11:65903375-65903397 GACCTCACCAGCTTCCACCCAGG + Intergenic
1084044793 11:66562327-66562349 GAGCTCCCCAGCTCCTTCCCAGG + Intronic
1084516135 11:69638917-69638939 CAGCTGCCCAGCCCCCACCTGGG - Intergenic
1084562953 11:69914410-69914432 AAGATGCCCAGCCCCCTCCCTGG - Intergenic
1084649885 11:70482956-70482978 GAGCTGTCCAGCTGCCACTCAGG + Intronic
1084710852 11:70843009-70843031 GAGCTGCCCACACCACACCCTGG + Intronic
1084740342 11:71135329-71135351 TTGCTGCCCAGCTGCCCCCCAGG + Intronic
1085262430 11:75214761-75214783 TGCCTGCCCAGCTCCCACCCAGG + Intergenic
1085296844 11:75436156-75436178 TAGATGCCCAGAACCCACCCTGG - Intronic
1085386389 11:76160567-76160589 CAGGTGTCCAGCTCCCAGCCTGG - Intergenic
1085483005 11:76838137-76838159 CAGCTGCCAAGGTCCCACCCAGG + Intergenic
1088084474 11:105960530-105960552 GTGCTGCCCTTCCCCCACCCAGG + Intronic
1088194520 11:107260171-107260193 GAGCTTCTCAGCTCCCAGCCAGG - Intergenic
1088767179 11:112993996-112994018 CAGCTGCACAGCTGTCACCCTGG + Intronic
1089297214 11:117476972-117476994 GAGGTGCCTAGCACCCAGCCTGG - Intronic
1090428031 11:126623651-126623673 GAGCTGCCCTGCACACAACCTGG - Intronic
1090731196 11:129574456-129574478 GAGCTGACCAGCCTCCAGCCAGG + Intergenic
1091178081 11:133579539-133579561 CTGCTGCGCAGCCCCCACCCTGG - Intergenic
1091686772 12:2567871-2567893 GAACAGCCCCCCTCCCACCCAGG - Intronic
1091786948 12:3248893-3248915 CACCTGCCCAGCTCCCAGGCTGG + Intronic
1091787777 12:3253377-3253399 GACCTGCCTAGCTCTCACCCTGG + Intronic
1094361808 12:29638838-29638860 GATCTGTCCTGCTCCCTCCCAGG + Intronic
1096116947 12:49060391-49060413 GAGCTGCCCCGCCCCCGGCCTGG + Intergenic
1099894981 12:88634044-88634066 GAGCTGTCCTGCTACCACCTGGG - Intergenic
1100886222 12:99073538-99073560 GAGCTGTCCAGCAGCCACCGGGG - Intronic
1102497463 12:113329544-113329566 GAGCTGCACAGCCCTCCCCCAGG + Intronic
1102862526 12:116349168-116349190 GAGAAGCCAAGCTACCACCCAGG + Intergenic
1102917629 12:116766496-116766518 GAGTTGGACAGCTCCCACACAGG + Intronic
1103271366 12:119676536-119676558 GAGCTGTCCAGTTCTCCCCCAGG + Exonic
1103561554 12:121795603-121795625 GAGCAACCCAGCTACCAGCCGGG + Intronic
1104335802 12:127893857-127893879 CACCTCCCCAGCTCCCTCCCAGG + Intergenic
1104623235 12:130333751-130333773 GAGCTGCCCAGCCTCTCCCCTGG - Intergenic
1104984899 12:132591290-132591312 GAGCAGCACAGCTCCCTGCCTGG + Intergenic
1105218668 13:18305936-18305958 CAGCTTCCCAGGTCCCATCCCGG + Intergenic
1105243593 13:18628633-18628655 GCGCTGCCCTGCTCCGGCCCTGG + Intergenic
1105891935 13:24688335-24688357 GAGCTGCCGAGCTCCTGGCCCGG + Exonic
1106208433 13:27620605-27620627 GAGCGGCCCAACCCGCACCCGGG + Intergenic
1106250055 13:27976319-27976341 GAGATGCACAGATCCCACCAGGG - Intergenic
1107714145 13:43181832-43181854 GGGCTGGCCAGCTCCAGCCCTGG + Intergenic
1107892922 13:44930168-44930190 CAACTGCCCAACTCCCTCCCAGG + Intergenic
1108160376 13:47632570-47632592 GTGCTGCCCTTCCCCCACCCAGG - Intergenic
1108678642 13:52760456-52760478 GCAGTGCCCAGATCCCACCCCGG - Intergenic
1110385708 13:74907942-74907964 GAGCTGCCCAACTTCCAGGCAGG + Intergenic
1110538319 13:76678509-76678531 AGGCTTCCCAGCTCCAACCCAGG + Intergenic
1110656593 13:78007393-78007415 GAGATTCCCAGCTCCCGTCCAGG + Intergenic
1111682921 13:91466261-91466283 CAGCTTCCCTGCTGCCACCCAGG + Intronic
1112157370 13:96832620-96832642 GAGCTGCCTACCTGCTACCCTGG + Exonic
1113670822 13:112174916-112174938 CAGCTGCCCAGGCCCCACCAAGG + Intergenic
1113676785 13:112213241-112213263 CTGCTGCCCTGCTCCCACCCTGG - Intergenic
1113770118 13:112902854-112902876 GGCCTGCCCAGCTCTCACCTCGG - Intronic
1113814165 13:113159936-113159958 GAGCTGCCTGGCTTCCTCCCCGG - Intronic
1114527623 14:23376584-23376606 GCGCGGCCTAGCCCCCACCCTGG - Intergenic
1114646539 14:24259413-24259435 CATCTGCCCCCCTCCCACCCGGG + Intronic
1117267581 14:54106036-54106058 CAACTGCCTAGGTCCCACCCCGG + Intergenic
1117530889 14:56659518-56659540 GGGCTGCCCAGTTCTCACCCAGG - Intronic
1119175169 14:72563375-72563397 GACCCTCCCAGCTCCCACCTGGG - Intronic
1119183575 14:72620538-72620560 GGGGTGCCCTGCTCTCACCCGGG - Intronic
1119601388 14:75979386-75979408 GAGCTGCCCACCTCCCAGGTGGG + Intronic
1120906527 14:89625628-89625650 GAGCCGCCCCACTCCCAGCCCGG + Intergenic
1121336102 14:93078411-93078433 GAGCTGACCAGGTCCCACTGTGG + Intronic
1122194570 14:100075340-100075362 GGGCTGCTCCGCTCCCATCCAGG + Intronic
1122234531 14:100324167-100324189 GAGCGGCCCAGCTCTGGCCCTGG + Intronic
1122352218 14:101102872-101102894 GAGCTGCCCCGATCCCCCCAGGG - Intergenic
1122364312 14:101185459-101185481 GATTTGCCCAGCTTCCTCCCGGG + Intergenic
1122856914 14:104564275-104564297 CAGCTGCCCAGTGTCCACCCAGG - Intronic
1122906352 14:104803354-104803376 CAGCGGCCCAGACCCCACCCTGG - Exonic
1123017895 14:105384288-105384310 GAGCTGCAAGGCTCCCACCGCGG - Intronic
1123049278 14:105532794-105532816 GAGCTGCCCACTTCTCCCCCGGG - Intergenic
1123112832 14:105881109-105881131 CAGCAGCCCAGCCCCTACCCAGG - Intergenic
1124223042 15:27866152-27866174 GAAAGGACCAGCTCCCACCCAGG + Intronic
1124499278 15:30212411-30212433 GAGCTCCCCTGCACCCACCAGGG + Intergenic
1124744301 15:32326259-32326281 GAGCTCCCCTGCACCCACCAGGG - Intergenic
1125004211 15:34799581-34799603 GAGCGGCCCAGCCTCCTCCCCGG + Intergenic
1128612752 15:69087225-69087247 GGGCTGCCCAGCTCCGGCCAGGG - Intergenic
1129038663 15:72665943-72665965 GGGGTGCTCAGCTCCCACCCTGG - Intronic
1129077038 15:73005742-73005764 CACCTCTCCAGCTCCCACCCTGG - Intergenic
1129211228 15:74071287-74071309 GGGGTGCTCAGCTCCCACCCTGG + Intronic
1129399175 15:75269800-75269822 GGGGTGCTCAGCTCCCACCCTGG - Intronic
1129402782 15:75294076-75294098 GGGGTGCTCAGCTCCCACCCTGG - Intronic
1130252201 15:82306950-82306972 GAGCAGCCCTGCTCCAGCCCGGG - Intergenic
1130950596 15:88583928-88583950 AAGCTGCCCTGCTGCCATCCAGG - Intergenic
1131522381 15:93126286-93126308 CAGCTGCTCAGCTTCCACCAGGG - Intergenic
1131796533 15:96023097-96023119 CAGCTGGCCAACTCCCACACAGG + Intergenic
1132237363 15:100232289-100232311 GGGAAGCCCACCTCCCACCCTGG - Intronic
1132337996 15:101061058-101061080 TACCTCCCCTGCTCCCACCCAGG - Intronic
1132395727 15:101472631-101472653 GAGCTGCTCAGCCTCCTCCCTGG - Intronic
1132466577 16:80166-80188 GGACTGCCCAGGTCCCATCCTGG + Intronic
1132655096 16:1038559-1038581 TAGCTGCCCCGCTCGGACCCTGG + Intergenic
1132676254 16:1122519-1122541 CAGTCGCCCAGCACCCACCCTGG - Intergenic
1132702965 16:1229815-1229837 GACCTCCCCAGAACCCACCCAGG + Intronic
1132705358 16:1241053-1241075 GACCTCCCCAGAACCCACCCAGG - Intronic
1132728432 16:1348802-1348824 CAGCTGCCCACCGCCCACCCAGG - Exonic
1134252276 16:12582775-12582797 GACCTGCCAAGCTGTCACCCCGG + Intergenic
1134811575 16:17171725-17171747 CAGCTGCCCAGCCCCAACCTGGG - Intronic
1135822151 16:25693418-25693440 AATCTGCCCAGCTCCAAGCCTGG + Intronic
1137556315 16:49472685-49472707 GAGCTGCCCCTACCCCACCCTGG + Intergenic
1137766174 16:50979361-50979383 GGGCTTCCCACCTCCCAGCCGGG - Intergenic
1138222803 16:55267268-55267290 GAGCAGCCCAGCTGCAGCCCAGG + Intergenic
1139214865 16:65117877-65117899 CTGCAGCCCAGCCCCCACCCCGG + Intronic
1139546585 16:67652715-67652737 GATCCGCCCAGGTCCCGCCCCGG - Intronic
1140061289 16:71572068-71572090 GAGCTCCCCACCTCCACCCCAGG + Intronic
1140113925 16:72025690-72025712 AAGCTGCCCATTTCCCACCGTGG + Intronic
1141443099 16:84042029-84042051 GAGCAGGCCAGCTCCCAGCGCGG + Exonic
1142186862 16:88698826-88698848 GGGCAGCCAAGTTCCCACCCTGG + Intronic
1142381337 16:89733954-89733976 GAGCGGCCCTGCCCCCACCCTGG + Exonic
1142426953 16:90006534-90006556 GAGCTCCGCAGCATCCACCCAGG - Intronic
1142550035 17:732711-732733 GCGCTGCGCCGCTCCCAGCCCGG + Exonic
1142597497 17:1036631-1036653 GGGGTGCCCAGCGCCCACACAGG + Intronic
1143622303 17:8087640-8087662 GGCCTGCCCGGCACCCACCCCGG - Exonic
1143784935 17:9249016-9249038 CACCTGCCCAGCTCTGACCCAGG - Intergenic
1145999616 17:29123292-29123314 GGGGTGCCCATCCCCCACCCGGG - Intronic
1146283911 17:31561618-31561640 TGGCTGCCCTGCACCCACCCTGG + Intergenic
1147171206 17:38620126-38620148 CAGCTGCCCAGCCCCCGTCCAGG + Intergenic
1147316310 17:39622065-39622087 CAACTTCCCAGCTCCCACCTGGG + Intergenic
1147663170 17:42128526-42128548 AATCTGCCCACCCCCCACCCAGG + Intronic
1147958996 17:44154768-44154790 GAGCAGCCCACTTCCCAGCCAGG + Intronic
1147971843 17:44222318-44222340 AGGCTGCCCCGCTGCCACCCGGG - Intergenic
1149013626 17:51883638-51883660 CAGTTTCCCAGCTCCCTCCCTGG + Intronic
1149583384 17:57767486-57767508 GAGCTGCTCAGCCCACACCTAGG - Intergenic
1150135575 17:62693144-62693166 GCCCGGCCCAGCTCCCACCCTGG - Exonic
1150352844 17:64458989-64459011 GGGCTGCCCCGCTCCCGACCTGG - Intronic
1150433851 17:65139258-65139280 CAGCTCCCCATCTTCCACCCCGG + Intronic
1150764915 17:67994971-67994993 AAGGTGCCCAGCTCCCAAGCTGG - Intergenic
1151470562 17:74315140-74315162 GGGCAGCCCACTTCCCACCCTGG - Intergenic
1151580045 17:74972532-74972554 GCCCTGCCCAGCCCCCAGCCCGG + Intronic
1151767172 17:76138535-76138557 CGGCTGCCCAGCCCCCTCCCTGG - Intronic
1152185987 17:78856542-78856564 GTGCTGGGCACCTCCCACCCTGG - Intronic
1152285943 17:79413494-79413516 CAGCATCCCCGCTCCCACCCAGG + Intronic
1152382450 17:79949109-79949131 CAGCCGCCCAGCTCCCGTCCAGG - Intronic
1152526035 17:80888856-80888878 GCTCTGCTCAGCTGCCACCCCGG - Intronic
1152635411 17:81428773-81428795 GAGCTGCCCACATCCCACCCCGG + Intronic
1152816032 17:82408591-82408613 GAGGGGCCCTGCTCCCTCCCAGG + Intronic
1154388507 18:13916835-13916857 GAGTGGCCCAGGTCCCACCCAGG - Intergenic
1154991269 18:21600441-21600463 GAGCCTCCCACCTCCCTCCCAGG + Intronic
1157293782 18:46427502-46427524 GAGCTGGCCAGTACCCTCCCGGG - Intronic
1157391850 18:47309772-47309794 CAGCTGACCACCTCCCACCTTGG + Intergenic
1157574203 18:48732797-48732819 GAGCTGTCCAGATCCCAGCCAGG + Intronic
1160019273 18:75167785-75167807 GAGCCGCCTCGCCCCCACCCTGG - Intergenic
1160237738 18:77099272-77099294 GGGCAGCACAGCTCCAACCCTGG - Intronic
1160238996 18:77109135-77109157 CAGCTGCTCACCACCCACCCAGG - Intronic
1160541799 18:79628002-79628024 GAGCTGCCCAGCGCCCGCCAGGG + Intergenic
1161029014 19:2049468-2049490 CACCTTCCCAGCTCCCAGCCAGG + Intronic
1161272424 19:3397443-3397465 GACCTGCCCAGCCCCCAGCCTGG - Intronic
1161359411 19:3838868-3838890 CAGCTGCCCAGCTGTCTCCCGGG + Intronic
1161470524 19:4454834-4454856 GAGCCGACCAGCTCCCAGCAGGG - Intronic
1163058855 19:14743590-14743612 CCACTGCCCAGCTCCCACCCAGG - Intronic
1163644102 19:18478602-18478624 AGGCTCCCCAGCTCCCACCTGGG - Intronic
1164522739 19:28991250-28991272 GAGCTGTCCTGCCACCACCCAGG - Intergenic
1165318885 19:35074124-35074146 CAGCTGCCCCGTCCCCACCCTGG + Intergenic
1165347443 19:35257743-35257765 TAGGTGCCCTGGTCCCACCCTGG + Intronic
1165373596 19:35425872-35425894 CAGCTCCCCAGCTCCAGCCCAGG - Intergenic
1165742572 19:38212373-38212395 GACCCGCCCAGCTGGCACCCTGG + Intronic
1166385827 19:42380215-42380237 GAGATCTCCAGCTCCCACCTGGG - Intergenic
1166730615 19:45057211-45057233 GAGCTGCCCAGCCCCGAGCCAGG - Intronic
1166783891 19:45356438-45356460 GAGCTGCCCAGACCCCACTGTGG + Intronic
1167078056 19:47260835-47260857 GCGCTGCCTAGCTCCTACCTTGG - Exonic
1167200499 19:48061948-48061970 CCGCAGCCCACCTCCCACCCAGG + Intronic
1168267428 19:55230455-55230477 GACCCGCCCTGCCCCCACCCCGG + Exonic
1168273866 19:55265557-55265579 GAGCCCCTCAGCACCCACCCTGG - Intronic
925177499 2:1795614-1795636 GGCCGGCCCAGCTCCCAGCCAGG - Intronic
926055095 2:9769717-9769739 GAGCCCCCCCGCTCCCATCCTGG - Intergenic
926219464 2:10925355-10925377 GAGCTCCCCAAATCCCACCCTGG - Intergenic
926219473 2:10925378-10925400 GAGCTCCCCAAATCCCACCCTGG - Intergenic
926219482 2:10925401-10925423 GAGCTCCCCAAATCCCTCCCTGG - Intergenic
926219495 2:10925445-10925467 GAGCTCCCCAAATCCCACCTGGG - Intergenic
926219505 2:10925468-10925490 GAGCTCCCCAAATCCCTCCCTGG - Intergenic
926219512 2:10925490-10925512 GAGCTCCCCAAATCCCACCTGGG - Intergenic
926219520 2:10925512-10925534 GAGCTCCCCAAATCCCACCTGGG - Intergenic
926219530 2:10925535-10925557 GAGCTCCCCAAATCCCTCCCTGG - Intergenic
926219537 2:10925557-10925579 GAGCTCCCCAAATCCCACCTGGG - Intergenic
926219547 2:10925580-10925602 GAGCTCCCCAAATCCCTCCCTGG - Intergenic
926220215 2:10931294-10931316 GAGCTGAGCAGCTGCCACCTGGG + Intergenic
926246317 2:11124249-11124271 GAGCCTCCCAGCTCCCACTCTGG - Intergenic
926290716 2:11527542-11527564 CAGATGCCCAGGTCCCACTCTGG - Intergenic
926310311 2:11670083-11670105 CCGCGGCCCAGCTCCAACCCGGG - Exonic
927492094 2:23527333-23527355 ATGCTGCCCAGCCCCCACCCTGG - Intronic
927598889 2:24422970-24422992 GAGCTGCGTGGCTCCCTCCCTGG + Intergenic
927894213 2:26771119-26771141 GAGCTCCCCACCTCCCACAGGGG - Intronic
929484434 2:42341360-42341382 GACCTGCCCAAGTCCCACCTGGG + Intronic
930747198 2:54896835-54896857 CAGGTGCCCAAATCCCACCCTGG + Intronic
931756092 2:65375931-65375953 GAGCTGAACTGGTCCCACCCTGG - Intronic
931788763 2:65644904-65644926 GTAATGCCCAACTCCCACCCGGG - Intergenic
931915527 2:66951040-66951062 GAGCAGCCCAACTCTCACCCTGG + Intergenic
932233857 2:70105584-70105606 GAGATGCCCAGCTCCAAGCCAGG - Intergenic
934567344 2:95347957-95347979 GAGCTGCCCAGCAGCCCCTCGGG + Intronic
934737227 2:96695672-96695694 GGGCTGCCCAGCCCCTGCCCTGG - Intergenic
935176071 2:100649631-100649653 GCCCTGCACAGCTCCCAACCTGG + Intergenic
936037693 2:109126071-109126093 CTGCTGCCCAGCTCCAGCCCTGG - Intergenic
937222809 2:120351842-120351864 CAGCTGCCCACCTCCAGCCCAGG - Intergenic
937994126 2:127680146-127680168 GTGCTTCCCCGCTCCCCCCCGGG - Intronic
938383206 2:130848116-130848138 CAGATGGCCTGCTCCCACCCTGG - Intronic
940047967 2:149429788-149429810 GAGCTGCCCAGCCAACCCCCAGG - Intronic
940967442 2:159855553-159855575 GACCCGCCCAGCTTCCAACCCGG - Intronic
943344531 2:186722842-186722864 GAGCTGCACAACTCCAAGCCAGG - Intronic
944566043 2:200991941-200991963 GATTTGCCCACCTCCCCCCCCGG - Intronic
945019358 2:205555859-205555881 GAGATGCAAAGCTCCCTCCCAGG + Intronic
948214989 2:236221953-236221975 CACATGCCCAGCACCCACCCTGG - Intronic
948274044 2:236694790-236694812 GAGGGGCCCAGCCCCCACCCAGG - Intergenic
948572804 2:238927938-238927960 GTGCTGCCAAGTTCCCACTCAGG + Intergenic
948859740 2:240747011-240747033 GATCCGCCCATCTCCCACCACGG - Intronic
948992651 2:241562623-241562645 GAGCTGCCCAGCCACCAGCGTGG + Intronic
1168883078 20:1224442-1224464 GTGCGGCCCTGTTCCCACCCGGG + Intergenic
1169276274 20:4235625-4235647 GTGCTGCTCTGCTCACACCCAGG - Intronic
1170702242 20:18713918-18713940 GAGCTGCCCAGAGCCCAGCACGG + Intronic
1171989867 20:31687717-31687739 GAGCTGCCTGCCTCCCTCCCGGG - Intronic
1172219396 20:33262832-33262854 GTACTTCCCAGCTACCACCCTGG + Intergenic
1172222710 20:33284737-33284759 GAGCTCTCCAGCTTGCACCCTGG - Intronic
1172765101 20:37346663-37346685 GATCCCCCCACCTCCCACCCGGG - Intronic
1172991843 20:39042401-39042423 GAACTGCCAAGCACCCACCTGGG + Intergenic
1173256650 20:41398542-41398564 AAGATGCCCAGCTCCCCTCCTGG + Intergenic
1175319182 20:58073375-58073397 GAGCAGCCCAGCACCCAGCAGGG + Intergenic
1175483431 20:59327517-59327539 GAGCTGCCCAGGTGCCACGGAGG + Intergenic
1175919831 20:62445653-62445675 GAGCTGCCCAGGACACTCCCAGG + Intergenic
1175959581 20:62628694-62628716 GTGCTACCCACCCCCCACCCCGG + Intergenic
1176291110 21:5045209-5045231 GAACTGCCCAGTTCCATCCCAGG + Intergenic
1179133551 21:38660479-38660501 GACCTGCCCGGCTCCCACGCTGG - Intronic
1179260169 21:39750905-39750927 GCACTGCTCAGCTCCCGCCCTGG - Intronic
1179569850 21:42272323-42272345 GAGATGCCAAGCACCCACACAGG - Intronic
1179646518 21:42779410-42779432 GGTCTTCCCAGCCCCCACCCTGG + Intergenic
1179866145 21:44218432-44218454 GAACTGCCCAGTTCCATCCCAGG - Intergenic
1179935190 21:44599521-44599543 AAGCAGCCCACCTCCCTCCCTGG + Intronic
1180061297 21:45386312-45386334 GGGCTGGCCCTCTCCCACCCTGG - Intergenic
1180228263 21:46411393-46411415 GAGCTGCTCTGCTCCCAGGCCGG + Exonic
1180551396 22:16544712-16544734 GAGCAGCCCAGCTCCTTGCCAGG + Intergenic
1181015561 22:20066594-20066616 GAGTTTCCCAGCTGCGACCCAGG + Intergenic
1181116529 22:20635412-20635434 GCCCTGCCCAGCTCAGACCCTGG + Intergenic
1181567904 22:23750980-23751002 GAGCTGCCCCGCCCCGGCCCAGG - Exonic
1182380424 22:29883268-29883290 GCGCTGCCCAGCGCCGGCCCTGG + Exonic
1182735395 22:32529341-32529363 GAGGTGGCCAGCCCCGACCCTGG - Intronic
1182787520 22:32920008-32920030 CCCCTCCCCAGCTCCCACCCAGG - Intronic
1183087976 22:35498947-35498969 GGGCTGCCCAGAACTCACCCTGG + Intergenic
1183303460 22:37069826-37069848 AGGCTGCCCATCTGCCACCCAGG - Intronic
1183314150 22:37128065-37128087 CAGCTGCCTGCCTCCCACCCTGG + Exonic
1183318050 22:37147804-37147826 GAGGTGAGCAGCCCCCACCCTGG - Intronic
1183345958 22:37308038-37308060 GAACTCCCCAGACCCCACCCCGG + Intronic
1184749637 22:46477929-46477951 GTGCTGCCCAGCATCCTCCCGGG - Intronic
1184992786 22:48182037-48182059 TACCCTCCCAGCTCCCACCCAGG + Intergenic
1185175882 22:49326301-49326323 GAGCAGCTCAGCTCCCACAGAGG - Intergenic
1185333947 22:50263291-50263313 ACCCTGCCCAGCCCCCACCCAGG + Intergenic
950530727 3:13551019-13551041 GTGCTGCCCACCCCCAACCCAGG + Intronic
951320496 3:21238615-21238637 GAGCTGTGCAGCTCCCTGCCTGG - Intergenic
952308531 3:32167022-32167044 CAGGTTCCCAGGTCCCACCCTGG + Exonic
952764721 3:36944504-36944526 GGCCTGCCTAGCTCCCACCCCGG - Intronic
953197698 3:40750025-40750047 GAGCTGCCCAACCTCCACCCAGG - Intergenic
954214522 3:49117041-49117063 CAGGTGCCCAGCTCTCACCTGGG + Exonic
954383405 3:50231711-50231733 GAGAAGCCCAGCTCACAGCCAGG + Intronic
954419814 3:50412891-50412913 GGGGTGCCCAGCACCCCCCCAGG - Intronic
954461125 3:50627663-50627685 GAGCTGCCAGGCCACCACCCTGG + Intronic
954677825 3:52325385-52325407 AGGCTGCCCAGAGCCCACCCAGG + Intronic
954692009 3:52400659-52400681 GAGATGCCCAGCGCCCTCCCAGG + Intergenic
956326609 3:68059909-68059931 GGGCTCCCCAGCTGCCTCCCAGG - Intronic
961328940 3:126127693-126127715 GGGCTGCCCATCTCCTCCCCTGG - Intronic
961536804 3:127575629-127575651 GGGCTCTCCAGCTCCCAGCCTGG + Intronic
962235170 3:133701065-133701087 AAGCTGGCCAGGTCCCTCCCGGG - Intergenic
963780183 3:149479203-149479225 GAGCTCCACAGGGCCCACCCTGG + Intronic
965339405 3:167468410-167468432 GAGCTGCCCAGCCCCCAGAGAGG - Intronic
967753338 3:193140317-193140339 CAGATGCCCTGCTCCCACCCCGG - Intergenic
967839961 3:193997288-193997310 TGGCTGCCCGGCCCCCACCCTGG - Intergenic
967849502 3:194071218-194071240 CAGCTGCCCCGCGCCCGCCCGGG - Intergenic
968503812 4:962958-962980 GCGCAGCCCATCCCCCACCCAGG + Intronic
968643305 4:1725889-1725911 CTGCTGCCCAGCTGCCACCTTGG - Intronic
969160968 4:5258671-5258693 CATCTCCCCAGCTTCCACCCTGG + Intronic
969487700 4:7481457-7481479 GATCTCCCCAGATGCCACCCAGG - Intronic
969712678 4:8853043-8853065 GGGCTGCCCACCTCCCACTGTGG + Intronic
975740277 4:77422950-77422972 GAGCTGCCCAGCTCTTGTCCTGG + Intronic
976931319 4:90570149-90570171 GGGATGCCCAGCTCCCATACTGG - Intronic
980392945 4:132169776-132169798 GTGCTGCCCTTCCCCCACCCAGG + Intergenic
983485542 4:168327949-168327971 AAGCTGGCCAGCTTCCAGCCAGG + Intergenic
984710281 4:182879024-182879046 GAGCTGTCCTGCCGCCACCCAGG + Intergenic
984868963 4:184310415-184310437 CAGCTGCCCTGCAGCCACCCTGG + Intergenic
985509954 5:307913-307935 GAGCTGACCAGCTGCGAGCCAGG + Intronic
985694760 5:1333896-1333918 AGGCTGCCCAGCTCCGCCCCTGG + Intronic
985800579 5:2003295-2003317 GAGCTGCCCCGATCCAACTCAGG + Intergenic
985846289 5:2351875-2351897 GAGCTGCAGAGCTCCCAGGCAGG - Intergenic
986311518 5:6554302-6554324 GAGGGGCCCTGGTCCCACCCTGG - Intergenic
986757798 5:10854332-10854354 GAGATCTGCAGCTCCCACCCAGG + Intergenic
990510107 5:56481837-56481859 GAGCTGGCCAGCTGCGAGCCAGG + Intronic
990954658 5:61330962-61330984 CTGCGGCCCGGCTCCCACCCCGG - Intergenic
995177778 5:109198505-109198527 GAGTTTCCCAGCTCCCAGCTTGG - Intergenic
995670209 5:114594466-114594488 GAGTTGCCCTGCTGCCACCCAGG + Intergenic
997228942 5:132228846-132228868 GAGATGCCCAGCCTCCGCCCAGG + Intronic
997236627 5:132275731-132275753 GTCCTGCCCAGCCTCCACCCAGG + Intronic
997523262 5:134536793-134536815 GAGTTGCACAGCTCCAAGCCCGG - Intronic
997626795 5:135336600-135336622 GACCTGCGCAGCTTCCTCCCGGG + Intronic
997632195 5:135377247-135377269 GTCCTGCCCAGCTGCCAGCCAGG - Intronic
998041869 5:138955625-138955647 TTGCTGCCCAGCACACACCCCGG + Intronic
998961083 5:147487863-147487885 GAACTCCCCACATCCCACCCTGG + Intronic
1000288402 5:159847330-159847352 GACCTTCCCAGCTCCCACTCTGG + Intergenic
1001116501 5:168945040-168945062 GAGCTGAACAGGTACCACCCTGG - Intronic
1001276650 5:170356066-170356088 CAGCTACCCTGCTCCCAGCCTGG - Intronic
1001403300 5:171459167-171459189 GGGGTGCCCACCTCCCACGCAGG - Intergenic
1001645512 5:173278819-173278841 GAGAAGCCCAGCGTCCACCCAGG - Intergenic
1001773318 5:174311655-174311677 GACCTTCCCAGCCCCCAGCCCGG + Intergenic
1001876935 5:175209841-175209863 GAGCTTCCTAGTTCTCACCCAGG - Intergenic
1002041853 5:176520528-176520550 GAGCAGCCGTGCTTCCACCCTGG - Intergenic
1002078985 5:176726697-176726719 GACCTGCCCAGCACCCAGGCAGG + Intergenic
1002348283 5:178563255-178563277 GAGCTGCCCAGCTGTCCCACAGG + Intronic
1002640654 5:180629124-180629146 GAGCTGCCCAGCTCCTGCACCGG - Intronic
1003500161 6:6696558-6696580 CAGCTCCCCAGCTCCCACTCTGG - Intergenic
1004154864 6:13158655-13158677 GAGATGTCCTGGTCCCACCCCGG + Intronic
1004901783 6:20201059-20201081 GAGCTGTCCTGCTGCCACCCAGG + Intronic
1005170596 6:22980553-22980575 ATGCTGCCCTTCTCCCACCCAGG - Intergenic
1006141732 6:31933505-31933527 AAGCTTCCCAGTTCCAACCCAGG - Intronic
1006319837 6:33313909-33313931 GACCTGCCCCACTCCCACCCTGG + Intronic
1006382281 6:33706534-33706556 CAGGTGCCCAACTCCCACCTCGG - Intronic
1006944270 6:37774466-37774488 CTGCTGCCCAGCTCTCATCCTGG - Intergenic
1007585995 6:42989801-42989823 GGGCTGTCCAGGTCCCTCCCAGG - Intronic
1007705766 6:43790319-43790341 GACCTGCCCAGATACCCCCCTGG + Intergenic
1011754273 6:90483151-90483173 GTGGAGCCCAGCTCACACCCAGG - Intergenic
1012444311 6:99292586-99292608 GAGCTGCCTAGCTCACATCCTGG + Intronic
1014769471 6:125444806-125444828 GTGCTGCTCAGCAGCCACCCAGG - Intergenic
1016464746 6:144314357-144314379 GAGCTGGCCAGCCCAGACCCAGG + Intronic
1018173641 6:161161319-161161341 GAGCTGCCCACTTCCTGCCCTGG + Intronic
1018933520 6:168258290-168258312 CAGCTGCCCAGACCCCTCCCTGG + Intergenic
1019045057 6:169139482-169139504 GAGCTGCTCAGCACCGGCCCTGG - Intergenic
1019499932 7:1359798-1359820 CAGCTGCCCAGCCCCACCCCGGG - Intergenic
1019686306 7:2384023-2384045 GGGCTCCCCAGCCCCCTCCCTGG + Intergenic
1020101281 7:5395472-5395494 GTGCCTCCCAGCTGCCACCCAGG + Intronic
1020137172 7:5593963-5593985 CCGCTGCCCACCTCCCACCCCGG + Intronic
1022339524 7:29455444-29455466 GAGTCACCCAGCTGCCACCCAGG + Intronic
1023773718 7:43583430-43583452 CACCTGCCCAGCTCCCGGCCCGG - Exonic
1029197149 7:98813388-98813410 GTGCTGCCCAGGTCCCCTCCTGG + Intergenic
1029686645 7:102153205-102153227 GAGGTGCCCAAGCCCCACCCAGG + Intronic
1031804561 7:126292602-126292624 GTGCTGCCCTTCCCCCACCCAGG - Intergenic
1031974321 7:128084329-128084351 GGGCTGGCCAGCTCTCACCCTGG + Intronic
1032427690 7:131834624-131834646 GAGCTGCTCAGCTGTCAACCTGG - Intergenic
1033791379 7:144795944-144795966 CAGCTGCACAGCCTCCACCCAGG + Intronic
1034536413 7:151728467-151728489 GGGCTGGCCAGCACCCAGCCAGG + Intronic
1034731218 7:153389073-153389095 GAGCTGTCTTGCTGCCACCCAGG + Intergenic
1035242680 7:157542527-157542549 GAGCTGCCCAGCGGCCTCTCAGG + Intronic
1035559647 8:594849-594871 GGGAAGCCCAGCTACCACCCAGG + Intergenic
1035957186 8:4094194-4094216 GTGCAGCCAAGCTCACACCCAGG - Intronic
1036672691 8:10802747-10802769 GAGCACCCCATCCCCCACCCTGG - Intronic
1039235514 8:35498260-35498282 AAGCAACACAGCTCCCACCCAGG - Intronic
1040392592 8:46962359-46962381 GAGCTGTCCTGCTGCCATCCAGG - Intergenic
1041031758 8:53743939-53743961 GATCTGCCTAGATACCACCCAGG + Intronic
1043284868 8:78516252-78516274 GAGCGGCCCCGCTCCCCCCGTGG + Exonic
1043421616 8:80104145-80104167 GAGCTGTCCAGCCACCATCCAGG + Intronic
1046097542 8:109579009-109579031 GGGATTCCCAGCTCCCAGCCAGG - Intronic
1047772237 8:128038833-128038855 GACCTGCCCAGCTCTCAGCAGGG - Intergenic
1048151929 8:131902965-131902987 GATCTGCCCACCGCCCACCTCGG + Intergenic
1048277073 8:133074700-133074722 GAGAAGCCCAGCCCCCAACCTGG - Intronic
1048991788 8:139764788-139764810 GAGCTGCCCACTCCCCACCACGG + Intronic
1049315593 8:141965327-141965349 GGCCTGCACAGATCCCACCCGGG - Intergenic
1049340930 8:142112325-142112347 GTGCTTCCCAGATGCCACCCAGG + Intergenic
1049379846 8:142306556-142306578 GAGCTGCTCACCCCACACCCAGG + Intronic
1049385064 8:142339008-142339030 GGCCAGCCCACCTCCCACCCTGG + Intronic
1049483557 8:142839604-142839626 GGGCTGACCTGCTCCCAACCAGG + Intronic
1049521604 8:143094307-143094329 GACCTGCCCAGGGCTCACCCAGG - Intergenic
1051975551 9:22943159-22943181 GCGCTGCACAGCTCCCAGGCGGG + Intergenic
1053381159 9:37650750-37650772 GGGCGGTCCCGCTCCCACCCGGG - Intronic
1055886697 9:81071287-81071309 GAGCTGGCCAGTTCCTAGCCTGG + Intergenic
1056506567 9:87263566-87263588 CAGCTGTCCTGCTCCCACCTGGG + Intergenic
1058652859 9:107193403-107193425 GAGATGGCCATCTGCCACCCAGG + Intergenic
1059380145 9:113917027-113917049 GGGGTGGCCAGCTCCCACCAAGG + Intronic
1059404716 9:114092586-114092608 CATCTGCCCGGCCCCCACCCTGG - Exonic
1060397749 9:123327915-123327937 GATCTGCCAAGCTGCCACCTGGG + Intergenic
1060791809 9:126490193-126490215 GAGCCAGGCAGCTCCCACCCTGG - Intronic
1060892580 9:127198196-127198218 GACCAGCCCAGCTCCCAACAGGG - Intronic
1061012031 9:127961419-127961441 GACCTGGCCAGCTCCCAACCTGG - Intronic
1061108863 9:128552752-128552774 GAGCTGCCCAGCTCCCACCCGGG - Intronic
1061485405 9:130918078-130918100 GGGCAGAGCAGCTCCCACCCTGG + Intronic
1061790898 9:133058291-133058313 CAGCTGCCCAGCTCCACCTCCGG - Exonic
1061947216 9:133915003-133915025 GTGCTTCCCTGCTCCCTCCCAGG - Intronic
1062105223 9:134751458-134751480 GAGGAGCCCAGCTCCAGCCCAGG - Intronic
1062242623 9:135548379-135548401 GAGCTGCCCAGGTCCCCCTGGGG + Intronic
1062263764 9:135677191-135677213 CAGGTGTCCAGCTCCCGCCCAGG + Intergenic
1062295816 9:135825943-135825965 GCTCTGCCCAGCTTCCCCCCGGG - Intronic
1062352515 9:136145975-136145997 GTGCTGCCCAGCTCCAAATCAGG - Intergenic
1062502626 9:136857897-136857919 GAGCTCCCAGGCTCCCAGCCTGG - Intronic
1062562467 9:137147763-137147785 GGGCTGCTCACCTCCCACTCAGG + Intronic
1185986568 X:4841536-4841558 GAGCTGTCCAGCTGCTGCCCAGG - Intergenic
1186350243 X:8732369-8732391 GAGGGGCCCAGCTCCCACGCAGG + Intergenic
1187803767 X:23095755-23095777 GGGATGCCCAGCTCCCATGCTGG - Intergenic
1188132411 X:26453218-26453240 GTGCTGGGCAGCTCCCACTCAGG - Intergenic
1189559291 X:42175970-42175992 CAGCTGTCCTGCTGCCACCCAGG + Intergenic
1195162634 X:102185475-102185497 GAGCTGTCCTGCTGCCACCCAGG - Intergenic
1195166695 X:102227083-102227105 GAGCTGTCCTGCTGCCACCCAGG - Intergenic
1195192165 X:102460005-102460027 GAGCTGTCCTGCTGCCACCCAGG + Intronic
1198017721 X:132628941-132628963 GAGCTGCCCAGCTGCTACACTGG - Exonic
1200068107 X:153514579-153514601 CTGCTTCCCAGCTCCCTCCCAGG - Intergenic
1200151752 X:153954643-153954665 GGGCTCCCCAGCACCCACGCTGG + Exonic
1201178431 Y:11323340-11323362 GAGCCTCCCAGCTCCCACCATGG + Intergenic
1201240625 Y:11954191-11954213 GAGCTGCCTCGCTCCCGGCCCGG + Intergenic