ID: 1061109688

View in Genome Browser
Species Human (GRCh38)
Location 9:128560028-128560050
Sequence AAAAATCAAAATTATCGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2528
Summary {0: 1, 1: 1, 2: 19, 3: 282, 4: 2225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061109688 Original CRISPR AAAAATCAAAATTATCGGCC AGG (reversed) Intronic
Too many off-targets to display for this crispr