ID: 1061112871

View in Genome Browser
Species Human (GRCh38)
Location 9:128587769-128587791
Sequence AGTCAAATGGGGCCTATGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061112871 Original CRISPR AGTCAAATGGGGCCTATGAT AGG (reversed) Intronic
904593622 1:31629080-31629102 ACTCACATGGGGACTATGAACGG + Intronic
906356698 1:45112960-45112982 TGTCAAGTGTGGCCTATTATAGG + Intronic
906478142 1:46183666-46183688 AGCCAAATGGGGCCTCAGGTGGG + Intronic
907836346 1:58112516-58112538 AGTAAAATGGAGACAATGATAGG + Intronic
907869976 1:58434111-58434133 AGTGAAATGGGGTCCATGGTTGG + Intronic
910646279 1:89518780-89518802 TTTCAAATTGGGACTATGATTGG - Intergenic
913134351 1:115873638-115873660 AGTCAAATGGATACTAAGATAGG - Intergenic
920568862 1:207001172-207001194 GCTCAAATGGGTCCTATTATTGG + Intergenic
1066052827 10:31651011-31651033 AGTTATAGGGTGCCTATGATGGG + Intergenic
1066494520 10:35929426-35929448 AGTTAGATGGGGCCCATGCTTGG + Intergenic
1069910311 10:71754698-71754720 AGTAAAATGGGGACAATGGTAGG + Intronic
1070282441 10:75059575-75059597 TGTAAAATGGGGCTAATGATAGG - Intergenic
1071108351 10:82124909-82124931 TGTCAAATGGGGATGATGATTGG - Intronic
1072959419 10:99915806-99915828 AGTAAAATGGGGACAATAATAGG - Intronic
1073112695 10:101072059-101072081 GCTCCAATGGGGCCTCTGATGGG + Intergenic
1075326044 10:121532989-121533011 AGTGACATGCGGCCTCTGATGGG + Intronic
1075401102 10:122162471-122162493 ATTCAAATGGAACCTCTGATGGG - Intronic
1077800078 11:5528237-5528259 ATACAAATGGGGCCTGTGAGAGG + Intronic
1084444079 11:69193341-69193363 AGCCAAATGGGGCATTTAATTGG + Intergenic
1087149439 11:94845422-94845444 CGTCAAATGGGGCTTATGTGAGG + Intronic
1091387245 12:103231-103253 AGACAAATGGGCTCTATGCTGGG - Intronic
1092223924 12:6734110-6734132 AGTCCAATGTGGCCTAGGCTGGG + Intergenic
1096752660 12:53771939-53771961 ATTCAAATGGGGGCTAGGAGAGG - Intergenic
1102216326 12:111163994-111164016 TGTCAAATGGGGCTAATCATTGG + Intronic
1103053937 12:117803818-117803840 TGTAAAATGGGGACAATGATGGG - Intronic
1106697886 13:32197580-32197602 AGTAAAATAGGGCTGATGATAGG + Intronic
1111350063 13:87016233-87016255 AGTCAAATGGCTCTCATGATAGG + Intergenic
1116419255 14:44713973-44713995 ACTCAAATGTGGCCCAGGATTGG + Intergenic
1124085480 15:26546065-26546087 AGACAACTGGGGCCTACCATTGG + Exonic
1125967445 15:43885866-43885888 AGACAAATGTGGACTATGAAGGG - Intronic
1134051504 16:11140908-11140930 TTTCAAATGGGGCTGATGATAGG + Intronic
1156019265 18:32580913-32580935 AGTCACATGGAGACTCTGATTGG + Intergenic
1158406034 18:57160179-57160201 AGCCAAATGTTGACTATGATTGG - Intergenic
1162429022 19:10615834-10615856 TGTCAAATGGGGATAATGATAGG + Intronic
929902980 2:46021905-46021927 AGTCATCTGGGGCCTTTCATAGG + Intronic
929903041 2:46022472-46022494 AGTCACATGGGGCCTTTCGTAGG + Intronic
931499554 2:62849990-62850012 GGAAAAATGGGACCTATGATGGG + Intronic
931996265 2:67842134-67842156 GGTCAAAAGGGGCCTATGAAAGG + Intergenic
932969548 2:76523718-76523740 AGAAAAATGGAGCCTCTGATGGG + Intergenic
935205350 2:100892063-100892085 AGTCAACTGGGGACTCTGATGGG - Intronic
942014606 2:171799281-171799303 TGTCAAAAGTGGCTTATGATAGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
1170431146 20:16278112-16278134 AGCCAAAGGGGGCCTAGGAGAGG + Intronic
1170564902 20:17593775-17593797 AGCCAAATGGAGCCCATTATTGG + Intronic
1171185815 20:23123326-23123348 TGTAGAATGGGGCCGATGATGGG + Intergenic
1175234609 20:57501444-57501466 AGTCAGAAGGGGCCTTAGATGGG + Intronic
950111909 3:10424071-10424093 AGCCGAGTGGGGCCTATGAGAGG - Intronic
951925950 3:27909047-27909069 AGGAAAATGGGGCCTCTTATTGG - Intergenic
953094423 3:39760915-39760937 AGTCACACTGGGCCTATGCTCGG + Intergenic
954580913 3:51702507-51702529 CCTCAAATGGGGCCTAGGTTGGG - Intronic
955408119 3:58638649-58638671 AGTCACACGGGGCCCATGCTTGG - Intronic
967132351 3:186483989-186484011 AGTTAAATGGGTCATAGGATGGG + Intergenic
970035541 4:11730914-11730936 AGTCAAATGGAGCACAAGATAGG - Intergenic
971472582 4:27042557-27042579 GGTCAAATGCAGCCTATGACAGG - Intergenic
972238902 4:37167560-37167582 TGTCTAATGCTGCCTATGATGGG - Intergenic
974132406 4:57772872-57772894 AGTCAAATGGGGTGTGCGATTGG + Intergenic
974574747 4:63703791-63703813 AGTCAAAGTGTGCCTATGGTTGG + Intergenic
982113188 4:152074630-152074652 AGTCTAATGGGGCCTCAGAGGGG + Intergenic
982869457 4:160559341-160559363 AGACAAATGGTCACTATGATAGG - Intergenic
983833551 4:172361677-172361699 AGTCAAAAGGGGCATAAAATGGG + Intronic
985371750 4:189292502-189292524 ACTCAAATGGGGACTCTGAGTGG - Intergenic
989000728 5:36757545-36757567 AGTCTCATGAGGCCTGTGATTGG + Intergenic
993781484 5:92071061-92071083 TGTCAACTGGGGCCTCTGTTAGG + Intergenic
998813710 5:145991877-145991899 ACTCAAATGGGGGCAATGAATGG - Intronic
1005201227 6:23347051-23347073 AGGCAAGTGAGTCCTATGATTGG + Intergenic
1016203554 6:141443600-141443622 ACTAAGATGTGGCCTATGATTGG + Intergenic
1018487885 6:164260670-164260692 AGCCAAATTGGGTCTATGAGGGG - Intergenic
1018763394 6:166909919-166909941 AGTGAAATGAGGCCTATGGATGG + Intronic
1020944846 7:14590519-14590541 AGTCACATGGGGTTTATGTTTGG - Intronic
1021309180 7:19071714-19071736 AGTCTAAAGGGGCCTAGGGTGGG - Intronic
1023156985 7:37261221-37261243 TGTCAAATAAAGCCTATGATAGG - Intronic
1028220822 7:88194803-88194825 AGTTAAATGGGGCTTGTGGTGGG - Intronic
1032924880 7:136592014-136592036 AGTCAAATGGAAACTATTATTGG + Intergenic
1038525171 8:28267037-28267059 AGTCAAATGTGCTCTAAGATGGG + Intergenic
1039151229 8:34508098-34508120 AATAAAATGGTGCCTATGTTGGG - Intergenic
1040863270 8:52022781-52022803 TGTCAGATGGGGCCTGTGAGAGG - Intergenic
1044060799 8:87632274-87632296 AGAGAAAGGGGGGCTATGATTGG + Intergenic
1048712286 8:137225757-137225779 AGTCACATGCTGCATATGATGGG + Intergenic
1048922964 8:139247291-139247313 AGTCACATCTGGCCTATGAAGGG - Intergenic
1048992454 8:139768870-139768892 AGTAAAATGAGGCCCAAGATGGG + Intronic
1048993080 8:139772779-139772801 AGTAAAATGAGGCCCAAGATGGG + Intronic
1051827885 9:21241200-21241222 TGTCAAATGGGTGCTGTGATTGG - Intergenic
1056606984 9:88093891-88093913 TGTAAAATGGGGCCAATTATGGG + Intergenic
1059505211 9:114792523-114792545 AGTTGCATGGCGCCTATGATAGG + Intronic
1059751774 9:117254143-117254165 TGTCAAATGGGGCCAATAATAGG + Intronic
1059830882 9:118094495-118094517 AGTCAAATTAGGCATACGATGGG - Intergenic
1061112871 9:128587769-128587791 AGTCAAATGGGGCCTATGATAGG - Intronic
1203778618 EBV:88193-88215 AGACTGATGGGGCCCATGATGGG - Intergenic
1186934511 X:14433272-14433294 AGTCAACTGGTGGCTATGCTTGG + Intergenic
1187128738 X:16480561-16480583 AGTTAAATGGGGCCAGCGATGGG - Intergenic
1189337837 X:40181402-40181424 AGTCACATGGGCCCCATGCTTGG + Intergenic
1192285482 X:69730577-69730599 AGTCAAATGAGGCCTCAGAGAGG - Intronic
1197752168 X:129972390-129972412 TGTCAAATGGGGTCCATGAAGGG + Intergenic
1198004646 X:132480528-132480550 TGCCAAATCGGGCCTTTGATGGG - Intronic