ID: 1061118262

View in Genome Browser
Species Human (GRCh38)
Location 9:128628100-128628122
Sequence GTGCCTTGCCCCATAGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 188}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061118257_1061118262 7 Left 1061118257 9:128628070-128628092 CCACCCTTCTCGTCACCTGATGA 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1061118262 9:128628100-128628122 GTGCCTTGCCCCATAGCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 188
1061118260_1061118262 3 Left 1061118260 9:128628074-128628096 CCTTCTCGTCACCTGATGAGGAG 0: 1
1: 0
2: 1
3: 5
4: 74
Right 1061118262 9:128628100-128628122 GTGCCTTGCCCCATAGCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 188
1061118261_1061118262 -8 Left 1061118261 9:128628085-128628107 CCTGATGAGGAGTGTGTGCCTTG 0: 1
1: 0
2: 2
3: 4
4: 118
Right 1061118262 9:128628100-128628122 GTGCCTTGCCCCATAGCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 188
1061118256_1061118262 8 Left 1061118256 9:128628069-128628091 CCCACCCTTCTCGTCACCTGATG 0: 1
1: 0
2: 0
3: 2
4: 109
Right 1061118262 9:128628100-128628122 GTGCCTTGCCCCATAGCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 188
1061118259_1061118262 4 Left 1061118259 9:128628073-128628095 CCCTTCTCGTCACCTGATGAGGA 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1061118262 9:128628100-128628122 GTGCCTTGCCCCATAGCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 188
1061118253_1061118262 13 Left 1061118253 9:128628064-128628086 CCCCTCCCACCCTTCTCGTCACC 0: 1
1: 0
2: 2
3: 49
4: 613
Right 1061118262 9:128628100-128628122 GTGCCTTGCCCCATAGCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 188
1061118254_1061118262 12 Left 1061118254 9:128628065-128628087 CCCTCCCACCCTTCTCGTCACCT 0: 1
1: 0
2: 5
3: 48
4: 620
Right 1061118262 9:128628100-128628122 GTGCCTTGCCCCATAGCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 188
1061118255_1061118262 11 Left 1061118255 9:128628066-128628088 CCTCCCACCCTTCTCGTCACCTG 0: 1
1: 0
2: 1
3: 26
4: 381
Right 1061118262 9:128628100-128628122 GTGCCTTGCCCCATAGCCCATGG 0: 1
1: 0
2: 0
3: 10
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061118262 Original CRISPR GTGCCTTGCCCCATAGCCCA TGG Intronic
900973131 1:6002358-6002380 GTGCCAGGCCCCAGAGGCCACGG - Intronic
901239300 1:7683729-7683751 GTGCCATGCTCCAAAGCACAGGG + Intronic
901579275 1:10227323-10227345 GTGCCTGGCCCACAAGCCCAGGG + Intronic
901829987 1:11886445-11886467 TTGCCTTTCCTCTTAGCCCAAGG - Intergenic
902132251 1:14272533-14272555 GTGCCTTGCTCCAAAGAGCAAGG + Intergenic
902359187 1:15932828-15932850 GGGCCTTGCCCCAGAGGACAGGG + Exonic
903250777 1:22052017-22052039 GTGACTTGCCCCAGATCACAGGG - Intergenic
905345639 1:37309339-37309361 GTGACTTGCCCCAAAACCTAGGG + Intergenic
905794480 1:40807842-40807864 TTTCCTTGCCCCCTAGACCAGGG - Intronic
907488649 1:54794769-54794791 CGGCCCAGCCCCATAGCCCAGGG + Intronic
907554026 1:55329132-55329154 TTGCCTTCCTCCAGAGCCCAAGG - Intergenic
909565120 1:77045150-77045172 GTGCCATGGGCCCTAGCCCATGG + Intronic
911957099 1:104251080-104251102 CTGCCATGGCCCATGGCCCATGG - Intergenic
920672436 1:208014850-208014872 GTGCCTAGATCCCTAGCCCAAGG - Intergenic
920853089 1:209642050-209642072 GCTCCTTGTCCCATGGCCCAGGG - Intronic
923446099 1:234072781-234072803 GACCCTTGCCCCCTTGCCCATGG - Intronic
924166487 1:241288605-241288627 GTGCTTTGCTGCAGAGCCCACGG + Intronic
924474448 1:244371028-244371050 GAGCCTGGCCCCACAGCCCCAGG - Intronic
924612678 1:245587064-245587086 GTACCTTGCCCCAAGCCCCATGG + Intronic
924854662 1:247864453-247864475 GTGCCTTGCCCCCAAGCCTGTGG + Intronic
1065321034 10:24510395-24510417 CTGCTGTGCCCCATAGCTCATGG + Intronic
1065361167 10:24890438-24890460 GTGCCTTGTTCCATAGCCACTGG - Intronic
1068814712 10:61296394-61296416 GTGCCTTTCCACAGAGGCCAGGG - Intergenic
1069216226 10:65824779-65824801 GTGACTTGCCCCATAGGGGATGG - Intergenic
1069883740 10:71610386-71610408 TTTCCTTGCCCCATAGCACAGGG + Intronic
1070448580 10:76534052-76534074 GTGCTTTGCCCCACAGGTCAAGG + Intronic
1070646498 10:78205550-78205572 GAGCCTTGCCCCAGAGAGCACGG + Intergenic
1072529658 10:96306991-96307013 GGACCTTGTCCCATACCCCATGG - Intronic
1073292503 10:102420226-102420248 GTGCCTTCCCCCATCATCCACGG - Exonic
1073561457 10:104500376-104500398 GTGCCTGCCCCCATACCCCTGGG + Intergenic
1074780821 10:116800696-116800718 GTACCTTGTCCCACAGTCCAGGG + Intergenic
1075121416 10:119667570-119667592 GTGCCTTTCCCCATCCCTCAGGG + Intronic
1076043675 10:127273458-127273480 ATGCCTGGCCCCATAGTCCAAGG - Intronic
1077083942 11:738216-738238 GGGCCCTGCCCCACACCCCAGGG - Intergenic
1077914890 11:6604602-6604624 GTGCCTTGCCCCCTAGCCTTTGG - Intronic
1080152274 11:29066955-29066977 GTGCCTTGCCACTGATCCCACGG + Intergenic
1082990435 11:59202641-59202663 CTGCCTGACTCCATAGCCCATGG - Intronic
1083849737 11:65358110-65358132 GTGCCTGGCCCCATAGAGCTAGG + Intergenic
1085421694 11:76367447-76367469 GTGTCTTGCTCTTTAGCCCAGGG + Intronic
1088816006 11:113421336-113421358 GTGCCTTAGCCCATTGCACAAGG + Intronic
1089227381 11:116937107-116937129 GTGTCTTCCCTCCTAGCCCATGG + Intronic
1090329794 11:125922238-125922260 GTCCTGTGCCCCAAAGCCCATGG + Intronic
1090385864 11:126357221-126357243 GTGCCTGGCCCCATTGCGCTGGG + Intronic
1090970298 11:131636642-131636664 GTGCGCTGCTCCAGAGCCCACGG + Intronic
1093397114 12:18696018-18696040 GTGCCTGACCCCAAAGCCCCCGG + Intronic
1095971571 12:47905226-47905248 GTGCCTTGCCCTATGGACGACGG - Intronic
1098399094 12:70054285-70054307 CTGCCTTTCCCCATAGCTAAAGG - Intergenic
1104347275 12:128011879-128011901 GTGCCTGGGCCCATTCCCCATGG - Intergenic
1112719341 13:102225222-102225244 TGGCCTTTCCCCTTAGCCCATGG + Intronic
1112955819 13:105056772-105056794 CTGCCTTCCCCCATAGCTGATGG - Intergenic
1115250488 14:31341418-31341440 GTGTCTTGCTCCATTGCCCAGGG + Intronic
1115433538 14:33348168-33348190 GTAACTTGCCCCATATCCCATGG + Intronic
1118351313 14:64974045-64974067 GTGCCTTACTCCAGAGCCCTTGG - Intronic
1118427990 14:65688255-65688277 CTGCCTTGCCCCTTAACCCCTGG + Intronic
1118635879 14:67748413-67748435 GTTCCTGGCCCCACTGCCCAAGG + Exonic
1120401125 14:84033304-84033326 GGGCCTTGCTCCATCACCCAGGG - Intergenic
1121573244 14:94963193-94963215 GTGCCAGGCCCTAGAGCCCAGGG + Intergenic
1121719793 14:96101334-96101356 ATGCCCGGCCCCCTAGCCCAGGG + Intergenic
1124893067 15:33750569-33750591 GGGCCTTAGCCCATAGCACAAGG - Intronic
1127821386 15:62659139-62659161 CTCCCTTTCTCCATAGCCCAGGG + Intronic
1129184740 15:73899250-73899272 GAGCCTTGCTCCATGGCCCCTGG + Intergenic
1129890444 15:79068216-79068238 GTGGCTTGGCTCTTAGCCCAGGG + Intronic
1134232188 16:12437849-12437871 GTGCCCTTCCCCCCAGCCCAGGG + Intronic
1135969328 16:27060864-27060886 CTGCCTGGCACCATAGCCTAGGG - Intergenic
1135989489 16:27209202-27209224 GTGACTTGCCCCAAGGCCTACGG - Intronic
1136453612 16:30368754-30368776 CTCCCTTCCCCCATAGCCCTAGG - Intronic
1137698217 16:50477085-50477107 CTGCCTTGTGCCAAAGCCCATGG + Intergenic
1137914438 16:52413723-52413745 GTGTTTTGCCACATTGCCCAGGG - Intergenic
1138557854 16:57783274-57783296 GCTCCTTGCCCCACAGCCCCTGG - Intronic
1139341698 16:66271710-66271732 GTGCCTGGCCCCAAAGACAAGGG + Intergenic
1139481666 16:67234154-67234176 AAGCCTTGCACCAGAGCCCAAGG - Exonic
1141161111 16:81629740-81629762 GTGCCGTGCCACAGCGCCCAAGG + Intronic
1141952515 16:87348082-87348104 GTGCAGTGGCCCATACCCCATGG - Intronic
1142312155 16:89320448-89320470 GTGCCTTGCCGCTCAGCACAGGG - Intronic
1145748395 17:27337588-27337610 GTGCCTGGCCCCAAGGCCCCAGG - Intergenic
1146175574 17:30664042-30664064 GTGCCCTCCCCCATTTCCCAAGG - Intergenic
1146349021 17:32080088-32080110 GTGCCCTCCCCCATTTCCCAAGG - Intergenic
1146895493 17:36538027-36538049 GTGTATTGCCACATACCCCAGGG - Exonic
1147597612 17:41727014-41727036 CTCCCTTGCCCCATAGGCCATGG - Intronic
1149487647 17:57055850-57055872 GTGCCTGGCCCCAAAGTCCTGGG - Intergenic
1152271639 17:79328407-79328429 ATGCCTGGCCCCATAGCCACTGG + Intronic
1154351238 18:13585101-13585123 GTGTCTGGCCCCATTGCCGATGG + Intronic
1155331384 18:24722104-24722126 GTTCCTTCCCCTATACCCCAAGG + Intergenic
1156498937 18:37544810-37544832 GTGGCTTGCCTCATGGCCCCTGG - Intronic
1156954774 18:42949110-42949132 ATGCCCTGCCACATAGACCATGG + Intronic
1157293004 18:46423282-46423304 TTGCCTTGGCCAATAGCCCCAGG - Intronic
1158266943 18:55669895-55669917 GCGACTTGCCACAAAGCCCAAGG + Intergenic
1158511127 18:58091557-58091579 GTGCCTGGCACCATTGCTCAGGG + Intronic
1158589724 18:58769001-58769023 GTGCCCTGCCCCCTGCCCCAGGG - Intergenic
1159442772 18:68502943-68502965 GTGCCCAGCCCCAGGGCCCACGG + Intergenic
1161616419 19:5273381-5273403 GTGCTTGTCCCCAAAGCCCAGGG + Intronic
1162013926 19:7833531-7833553 GTGCCTTCCCCAACACCCCAGGG - Intronic
1162366212 19:10251224-10251246 GTCCCTTACCCCCTAGACCAGGG - Intergenic
1162516401 19:11150600-11150622 GGGTTTTGCCACATAGCCCAGGG - Intronic
1162983388 19:14253868-14253890 GTGCCCTCCCCCATTTCCCAAGG + Intergenic
1164913002 19:32027394-32027416 GTTCCATCCCCCAAAGCCCAAGG - Intergenic
1168722225 19:58560463-58560485 TTGGCTTGGCCCATGGCCCAGGG + Intergenic
925322958 2:2991003-2991025 GGGCCTGGCCTCACAGCCCAGGG + Intergenic
926797767 2:16632920-16632942 CTGCCTTCCCCAATAGCACAGGG + Intronic
927467204 2:23346406-23346428 CTGCCTTTCCTCAAAGCCCATGG + Intergenic
927883453 2:26704703-26704725 GTGCCTGCCCCCAAAGCCCCAGG - Intronic
928030703 2:27776342-27776364 GGGCCTGCCCCCATTGCCCAGGG + Intronic
929913572 2:46114709-46114731 GTGCCCAGCCCCAGAGTCCAAGG + Intronic
930769613 2:55118436-55118458 GGGTCTTGCTCCATTGCCCAGGG - Intergenic
931287310 2:60843264-60843286 GGGTCTTGCTCCATTGCCCAGGG + Intergenic
932477175 2:72013538-72013560 CTGCCTTCACCAATAGCCCAGGG - Intergenic
934502682 2:94872342-94872364 GTGCCTTGTGGCTTAGCCCAGGG - Intronic
936093624 2:109516101-109516123 CTCCCATGCCCCTTAGCCCAGGG - Intergenic
937154344 2:119708049-119708071 TGGCCTTGCCCCCCAGCCCAGGG + Intergenic
937499981 2:122467651-122467673 GTGCCATGCTCCAAAGCCCTTGG - Intergenic
939040802 2:137187357-137187379 GTGACTTGCCACATAGACCATGG + Intronic
943488099 2:188514131-188514153 GAGCCTTGCCCGATAGCTCGGGG - Intronic
946022930 2:216653996-216654018 GACCTTTGCACCATAGCCCATGG + Intronic
946381103 2:219349608-219349630 GTGCCCTGCCTCATATCCAATGG - Intergenic
947587221 2:231363931-231363953 GTGCCTTCCCCCAACCCCCATGG + Intronic
948861131 2:240753052-240753074 GTGGATGGCCCCAGAGCCCAGGG - Intronic
1169158406 20:3354388-3354410 GTGCCTTGGCCCTTAGCCAGAGG + Intronic
1170303647 20:14913939-14913961 CTGCCTTGCGCTATGGCCCAAGG - Intronic
1170509445 20:17061361-17061383 GTGCCTTGGCCAAGATCCCAAGG + Intergenic
1170694314 20:18644851-18644873 GCGCCTGGCCCCATACGCCACGG - Intronic
1172006873 20:31823942-31823964 GTGCCCTCCCCCAGGGCCCAGGG + Intronic
1172216975 20:33242566-33242588 GTGCCCTTCCCCACACCCCAGGG + Intronic
1172883960 20:38219151-38219173 GTGCCGTGCCCCACAGCTCCAGG + Intronic
1174087448 20:48019276-48019298 GTGACTTGCTCCACATCCCAAGG + Intergenic
1174128838 20:48327694-48327716 GTGACTTGCTCCACATCCCAAGG - Intergenic
1174357937 20:50010500-50010522 GGGCCGTGCCCCATGGCCTAAGG + Intergenic
1174442612 20:50568041-50568063 GAGTTTTGTCCCATAGCCCAAGG + Intronic
1174610996 20:51798889-51798911 CTGCCTCGCCCCAGAGCCCAAGG - Intronic
1175838120 20:62009321-62009343 CTGGCCTGCCCCATGGCCCAGGG - Intronic
1176024125 20:62977270-62977292 CTGCCTTGCCCCCCAGCCCCAGG + Intergenic
1176309456 21:5142019-5142041 GAGCCTTGCCCCTGTGCCCACGG + Intronic
1179309863 21:40185850-40185872 GTGCCTCACCCCTGAGCCCAGGG + Intronic
1179416099 21:41199776-41199798 GTGCCCTGCCCCTCAGGCCAGGG + Intronic
1179847604 21:44120014-44120036 GAGCCTTGCCCCTGTGCCCACGG - Intronic
1180174765 21:46082214-46082236 GTGCAGGGCCCCAGAGCCCAGGG + Intergenic
1180752046 22:18131256-18131278 GTGCCTGGCCCCAGTACCCAGGG + Exonic
1180990099 22:19930552-19930574 GTGCCTTCCCCCAGGGTCCATGG - Intronic
1181011095 22:20040991-20041013 GTGCCATGCCCTAGAGCCCTTGG - Intronic
1184640176 22:45866487-45866509 GTCCCTTCCCCCATGGCCTACGG - Intergenic
1184730651 22:46369379-46369401 GTGCTTCGCCCCACAGGCCAGGG - Intronic
1185314219 22:50171758-50171780 TTGCCTTGGCCCAGACCCCAGGG - Intronic
950157427 3:10733172-10733194 GTGCCTTGTTCCATAGCTGATGG - Intergenic
952819459 3:37473421-37473443 GAGCCTGGCCCGACAGCCCAAGG + Exonic
952835825 3:37601044-37601066 GTGGCTTTCCCCATGGACCATGG + Intronic
965838563 3:172878198-172878220 GTGCCTTCCTGCATAACCCATGG + Intergenic
966890712 3:184405662-184405684 GAGCATTGCCCCACAACCCAAGG - Intronic
967439196 3:189487532-189487554 GTCACTAGCCCCATAACCCAAGG - Intergenic
968783468 4:2600777-2600799 CTGCCTTGGCCCATGACCCATGG + Intronic
978295455 4:107199530-107199552 ATGCCTTGCCCCATTGCCCCTGG - Intronic
978852041 4:113350167-113350189 CTGCCTTGGCTCATAGCCCCTGG - Intronic
981584803 4:146289286-146289308 CTGCCTTTCACCATAGCCCTGGG - Intronic
983056688 4:163105170-163105192 CTGCCTTAACCCAGAGCCCATGG - Intergenic
985476422 5:81862-81884 GTGCCTGGTCACAGAGCCCAGGG + Intergenic
985615740 5:919901-919923 TTGCCTTGCTGCATAGGCCATGG + Intergenic
985630405 5:1010950-1010972 TGGCCTTGCCCCATGGCCCTGGG - Intronic
986029177 5:3879851-3879873 ATGCCTTTCTCCCTAGCCCATGG + Intergenic
986419525 5:7564714-7564736 GTACCTTTCCTCAAAGCCCAAGG - Intronic
987526229 5:19053427-19053449 GCACCTTGACCCATATCCCAGGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
993493933 5:88586585-88586607 TTGCCTTGCCACAGAGCACAGGG - Intergenic
997697486 5:135873052-135873074 CTCCCTTGCCCCTCAGCCCATGG - Intronic
999073980 5:148777594-148777616 GTGTCATGCTCCAAAGCCCAGGG - Intergenic
999907822 5:156162894-156162916 CTGCCTTGCCTCATCCCCCAGGG - Intronic
1000244792 5:159440452-159440474 GTGCAGCGCCCCATAGCGCATGG - Intergenic
1001734383 5:173987055-173987077 GGGTCTTGCTCCATTGCCCAGGG + Intronic
1003766944 6:9248361-9248383 GGGCCTTGCCCCATGCTCCAGGG - Intergenic
1009418774 6:63442964-63442986 GTGCCTGGTCCCATCGCCAAGGG - Intergenic
1016261150 6:142172449-142172471 GGGCATTGCCCCATACCCTAGGG - Intronic
1017123577 6:151045854-151045876 GTGCCTTCCTCCACAACCCAGGG + Intronic
1018381569 6:163262659-163262681 CAGACTTGCCCCATAGCTCATGG + Intronic
1018771668 6:166976294-166976316 GTGGCTTGCTCCAGAACCCAAGG - Intergenic
1026019848 7:66698267-66698289 GGGCCATGCCCCTTAGACCATGG + Intronic
1026880514 7:73904301-73904323 GGGCCATGCCCCTTAGACCATGG - Intergenic
1034406023 7:150902969-150902991 GTCCATTGCCCCATGGTCCATGG - Intergenic
1034470022 7:151249942-151249964 GGGCCTTGTTCCAAAGCCCACGG - Intronic
1034656824 7:152736372-152736394 GTGCCTGGCCCAAGAGCCCCTGG + Intergenic
1039252975 8:35687111-35687133 GTTCCTTGCCACAGAACCCATGG - Intronic
1041898057 8:62949061-62949083 GTGACTCTCCCCATAGCCCCTGG + Intronic
1044628480 8:94257058-94257080 GTGCCTTCCCACCTAGCTCAGGG + Intronic
1048473719 8:134724818-134724840 GTGAATTCCCCCACAGCCCATGG - Intergenic
1049188375 8:141271415-141271437 GTGCCCTGCCCCACAGGCCCTGG - Intronic
1049373380 8:142278151-142278173 GTGCCCAGGCCCATCGCCCAAGG + Intronic
1050970043 9:11858920-11858942 GTGTCCTGCCCCATACCCAAAGG - Intergenic
1052059793 9:23946105-23946127 GGGCCATGCGCCATAGCCCCAGG + Intergenic
1054762583 9:69016180-69016202 TTGCCTTGACCCAAAGCACAAGG - Intergenic
1059819492 9:117956475-117956497 CTGCCCTGCCCCATAGCCTGTGG - Intergenic
1061118262 9:128628100-128628122 GTGCCTTGCCCCATAGCCCATGG + Intronic
1061131054 9:128708042-128708064 GCGTCTTGCCCCGTCGCCCAGGG - Intronic
1061480288 9:130894681-130894703 GTGACTTGCCCCAGATCTCATGG + Intergenic
1061589752 9:131590726-131590748 GTGTCTTGGCCCACAGCACAGGG + Intronic
1062347534 9:136122285-136122307 GGGACTTGCCCTATAACCCAAGG - Intergenic
1062353673 9:136151973-136151995 GGGCCTTTCCCAATATCCCAGGG - Intergenic
1187048901 X:15676270-15676292 GTGCCTTGCCCCAGAGCCGGAGG + Intergenic
1192139678 X:68637177-68637199 GTGCTTTGTCCCAAATCCCATGG + Intergenic
1192351696 X:70361312-70361334 GGGCCTTGCCCCAAATGCCATGG + Intronic
1193185126 X:78502473-78502495 GAGACTTGCCCCATGTCCCATGG - Intergenic
1195323933 X:103743025-103743047 CAGCCTGGCCCCAGAGCCCATGG + Intergenic
1199732421 X:150649188-150649210 GTGCCTTGTCCCAGATCACATGG + Intronic
1199795670 X:151193307-151193329 GTGCCTGGCCCCAAAGGTCAAGG + Intergenic