ID: 1061120283

View in Genome Browser
Species Human (GRCh38)
Location 9:128637772-128637794
Sequence CTTGCTTTCAGCCCTGCAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061120280_1061120283 5 Left 1061120280 9:128637744-128637766 CCCACGATTTTTTGTCAAGCTCT 0: 1
1: 0
2: 0
3: 4
4: 96
Right 1061120283 9:128637772-128637794 CTTGCTTTCAGCCCTGCAGCCGG No data
1061120281_1061120283 4 Left 1061120281 9:128637745-128637767 CCACGATTTTTTGTCAAGCTCTG 0: 1
1: 0
2: 1
3: 6
4: 106
Right 1061120283 9:128637772-128637794 CTTGCTTTCAGCCCTGCAGCCGG No data
1061120279_1061120283 13 Left 1061120279 9:128637736-128637758 CCTGGCTGCCCACGATTTTTTGT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1061120283 9:128637772-128637794 CTTGCTTTCAGCCCTGCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061120283 Original CRISPR CTTGCTTTCAGCCCTGCAGC CGG Intronic
No off target data available for this crispr