ID: 1061121214

View in Genome Browser
Species Human (GRCh38)
Location 9:128643707-128643729
Sequence CTCTGGGAATCGTGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061121210_1061121214 -5 Left 1061121210 9:128643689-128643711 CCAAGACGACGTGTTGGACTCTG 0: 1
1: 0
2: 1
3: 1
4: 33
Right 1061121214 9:128643707-128643729 CTCTGGGAATCGTGGAAAGAAGG No data
1061121209_1061121214 -4 Left 1061121209 9:128643688-128643710 CCCAAGACGACGTGTTGGACTCT 0: 1
1: 0
2: 1
3: 3
4: 24
Right 1061121214 9:128643707-128643729 CTCTGGGAATCGTGGAAAGAAGG No data
1061121207_1061121214 19 Left 1061121207 9:128643665-128643687 CCTGGGCAACAGAGCAAGTAAAG 0: 1
1: 6
2: 69
3: 417
4: 3612
Right 1061121214 9:128643707-128643729 CTCTGGGAATCGTGGAAAGAAGG No data
1061121206_1061121214 23 Left 1061121206 9:128643661-128643683 CCAGCCTGGGCAACAGAGCAAGT 0: 173
1: 21237
2: 68494
3: 154671
4: 197382
Right 1061121214 9:128643707-128643729 CTCTGGGAATCGTGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061121214 Original CRISPR CTCTGGGAATCGTGGAAAGA AGG Intronic
No off target data available for this crispr