ID: 1061121725

View in Genome Browser
Species Human (GRCh38)
Location 9:128647374-128647396
Sequence TTCCTAGGCCACTCTCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061121711_1061121725 29 Left 1061121711 9:128647322-128647344 CCCCCGGGGGAAGTCAGAGAAAG 0: 1
1: 0
2: 0
3: 18
4: 156
Right 1061121725 9:128647374-128647396 TTCCTAGGCCACTCTCAGAGGGG No data
1061121712_1061121725 28 Left 1061121712 9:128647323-128647345 CCCCGGGGGAAGTCAGAGAAAGA 0: 1
1: 0
2: 0
3: 15
4: 207
Right 1061121725 9:128647374-128647396 TTCCTAGGCCACTCTCAGAGGGG No data
1061121713_1061121725 27 Left 1061121713 9:128647324-128647346 CCCGGGGGAAGTCAGAGAAAGAA 0: 1
1: 0
2: 2
3: 28
4: 409
Right 1061121725 9:128647374-128647396 TTCCTAGGCCACTCTCAGAGGGG No data
1061121714_1061121725 26 Left 1061121714 9:128647325-128647347 CCGGGGGAAGTCAGAGAAAGAAA 0: 1
1: 0
2: 3
3: 64
4: 606
Right 1061121725 9:128647374-128647396 TTCCTAGGCCACTCTCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061121725 Original CRISPR TTCCTAGGCCACTCTCAGAG GGG Intronic
No off target data available for this crispr