ID: 1061128121

View in Genome Browser
Species Human (GRCh38)
Location 9:128689476-128689498
Sequence CACACGCGCGGGCGCCCGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061128121 Original CRISPR CACACGCGCGGGCGCCCGCT CGG (reversed) Intronic
907247267 1:53116164-53116186 CACAGGCGGTGGCTCCCGCTGGG - Intronic
910773383 1:90851574-90851596 ACCACGCGCGGGCTCCCGCCGGG + Intergenic
924172637 1:241357416-241357438 CACACGCGCGGGCGAGCGGGCGG - Intergenic
1072283819 10:93894256-93894278 CCAACCCGCCGGCGCCCGCTCGG - Intronic
1072673102 10:97446155-97446177 CACACGCGCAGGCGCCAGCGTGG - Exonic
1083656051 11:64230316-64230338 GACAGGCGCGGGCGCCCACCTGG - Exonic
1085011020 11:73141961-73141983 CACACACGCGCGCGCTCGCTGGG - Exonic
1089368372 11:117934931-117934953 CACACTCGAGGGCGACAGCTCGG + Intergenic
1092757622 12:11778292-11778314 CACACGCGTGTGCGCTCGCCAGG - Intronic
1096101297 12:48971835-48971857 CGCGCGCGCGCGCGCGCGCTGGG - Intergenic
1097232853 12:57522839-57522861 CGCATGCGCGGGAGGCCGCTCGG + Exonic
1104930796 12:132338469-132338491 CACACGCGTGGGCGGCCTCGTGG - Intergenic
1110596480 13:77326394-77326416 CACACACGCGGGTGCACGCGCGG + Intronic
1113962111 13:114132105-114132127 CACACGCTCGGGCGCACACGCGG + Intronic
1114461078 14:22886580-22886602 CACCGGCTCAGGCGCCCGCTGGG - Intronic
1120765343 14:88323249-88323271 CACACTCCCGGGCGCGCGCTTGG + Exonic
1123025058 14:105420311-105420333 CACCCCCGCGGCCGCCCCCTCGG - Intronic
1129676053 15:77632854-77632876 CTCCCGCGCCGGCTCCCGCTCGG + Intronic
1131513821 15:93064557-93064579 CACACGCGTGTGCGCAGGCTGGG - Intronic
1132668554 16:1093451-1093473 CACACACGCGCGCGCGCGCCCGG + Intronic
1133212804 16:4272581-4272603 CACACGCGCGCCCGCCCGGGCGG + Intronic
1137352929 16:47729893-47729915 CACACGCGCGCGCGCGCGCGCGG - Intergenic
1137531736 16:49282329-49282351 CCCTCGCGCCCGCGCCCGCTGGG - Intergenic
1138478065 16:57283813-57283835 CTCCCGCGCGGGCGCCCACAGGG + Intronic
1140201285 16:72896933-72896955 CACACCCGTGGCCGCCCTCTCGG + Intronic
1140462246 16:75148960-75148982 CCCGCGCGCGCGCGCCCGCCGGG - Intronic
1142070044 16:88086950-88086972 CACATGGGCGGGTGCCCGCCTGG + Intronic
1142417264 16:89949352-89949374 CACACCCGCGGGAGCTCGCCCGG - Intronic
1149539189 17:57455880-57455902 CCCACACGCGGGCACCAGCTGGG - Intronic
1149677250 17:58477023-58477045 CACACGCGCGGGCGCTTGCTGGG + Intronic
1152417679 17:80173321-80173343 CACACGCGCGCGCGCGCGCGCGG + Intronic
1152769030 17:82156417-82156439 GACACGGGCGGGCGCCTCCTTGG - Intronic
1155928784 18:31685013-31685035 GCCACGCGCGGGGGCCCGCGGGG + Intronic
1156008385 18:32470238-32470260 CACACGCGCGCACACCCGCGTGG + Intronic
1160777757 19:864057-864079 CACACGCGCGAAGGCCCGCCAGG + Intergenic
1162486102 19:10961316-10961338 CACGCGCGCGGCTGCCGGCTGGG - Intronic
927636854 2:24822856-24822878 CACACGCGCGGAGCCCCCCTAGG - Intronic
933278049 2:80303692-80303714 CACAGCTGCGGGCACCCGCTGGG + Exonic
937134940 2:119544455-119544477 CGCCAGCGCCGGCGCCCGCTCGG - Exonic
1170226310 20:13995353-13995375 CGCACGCGCAGGCGCAGGCTCGG - Exonic
1170313698 20:15019158-15019180 CACACACGCGCGCGCGCGCGCGG + Intronic
1170882536 20:20309875-20309897 CACACGCATGGGTGCCCTCTTGG + Intronic
1174467772 20:50731034-50731056 CGCACGCGCGAGCGCGCGCCTGG - Intergenic
1176550492 21:8218941-8218963 CGCACGCGCGCGCGCGCGCGCGG - Intergenic
1176577334 21:8446211-8446233 CGCACGCGCGCGCGCGCGCGCGG - Intergenic
1179128102 21:38610509-38610531 CACACGCGCGTGCGCGCACGTGG - Intronic
1181956188 22:26589641-26589663 CACGCGCCCTGGCGCCCGCCTGG + Intronic
1184856813 22:47150798-47150820 CACACGCACGGGAGCCCCGTGGG - Intronic
1203255389 22_KI270733v1_random:135280-135302 CACGCGCGCGCGCGCGCGCGCGG - Intergenic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
950093064 3:10311048-10311070 CACAGGCAGGGGCCCCCGCTGGG - Intronic
952152292 3:30606625-30606647 CCCCCGCGCGTGCACCCGCTCGG + Exonic
954698998 3:52441973-52441995 CGCACGCGAGGGCTCCTGCTTGG - Intronic
961305721 3:125958377-125958399 CGCACGCGCGGGCGCCGGCTCGG - Intergenic
962350547 3:134652653-134652675 CACACGCGCGCGCGCACACCTGG + Intronic
988254945 5:28809288-28809310 CACCTGCGCAGGCGCCGGCTGGG + Intergenic
997317498 5:132949699-132949721 CACGCGCGCGCGCGCGCGCCAGG + Intronic
1003018738 6:2491255-2491277 CACACACGCTCGCGCGCGCTGGG - Intergenic
1003942604 6:11044127-11044149 CGCCCGCGCCGGCGCCCGCTCGG + Intronic
1004272901 6:14211172-14211194 CGCCCCCGCGGGCTCCCGCTCGG + Intergenic
1006390298 6:33754376-33754398 AACACGCGTGGCCGCCCCCTAGG - Intergenic
1013155656 6:107489811-107489833 CAGGGGCGCCGGCGCCCGCTCGG - Intergenic
1013426926 6:110020770-110020792 CACACACGCGGGCTCCCACTGGG - Intergenic
1013836421 6:114341589-114341611 CACACACGCGCGCGCGCGCGCGG - Intronic
1017738134 6:157381674-157381696 CCCTCGCGCGGCTGCCCGCTCGG - Exonic
1031899418 7:127392807-127392829 CACAGGCGGGGGCGCCGGCCGGG - Intronic
1034979365 7:155466532-155466554 CTCTCGCGGGGGCGCCTGCTTGG - Intergenic
1039411630 8:37359906-37359928 CACACTCGTAGGCGCCCTCTCGG - Intergenic
1040495210 8:47960141-47960163 CTCCCGCGCGTGCGCCCGCTCGG + Exonic
1049936410 9:504909-504931 CGCACGAGCGGGAGCCCGCGGGG - Intronic
1052436013 9:28430094-28430116 CACACACGCGCGCGCGCGCGTGG - Intronic
1053003160 9:34589064-34589086 CACACGCGCGCGCGGGCGCGCGG + Intronic
1055454308 9:76459038-76459060 TACAGGCGAGGGCGCCCTCTGGG - Intronic
1057708016 9:97411966-97411988 CCCACGCGCGGACGCCGGCGTGG + Exonic
1060480294 9:124013399-124013421 CACACGGGCTGGGGCCCTCTTGG - Intronic
1061128121 9:128689476-128689498 CACACGCGCGGGCGCCCGCTCGG - Intronic
1061128356 9:128690173-128690195 CACGCGGGCGGCCGCGCGCTGGG + Intronic