ID: 1061128383

View in Genome Browser
Species Human (GRCh38)
Location 9:128690259-128690281
Sequence TTCTCCGCACGCTGGCGCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 22}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061128383_1061128394 18 Left 1061128383 9:128690259-128690281 CCGTCGCGCCAGCGTGCGGAGAA 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1061128394 9:128690300-128690322 TGTATCGGGGGTCTTGGAAATGG 0: 1
1: 0
2: 1
3: 10
4: 86
1061128383_1061128392 12 Left 1061128383 9:128690259-128690281 CCGTCGCGCCAGCGTGCGGAGAA 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1061128392 9:128690294-128690316 GACCAGTGTATCGGGGGTCTTGG 0: 1
1: 0
2: 0
3: 6
4: 43
1061128383_1061128389 5 Left 1061128383 9:128690259-128690281 CCGTCGCGCCAGCGTGCGGAGAA 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1061128389 9:128690287-128690309 GCGCCGCGACCAGTGTATCGGGG 0: 1
1: 0
2: 0
3: 0
4: 6
1061128383_1061128388 4 Left 1061128383 9:128690259-128690281 CCGTCGCGCCAGCGTGCGGAGAA 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1061128388 9:128690286-128690308 GGCGCCGCGACCAGTGTATCGGG 0: 1
1: 0
2: 0
3: 0
4: 15
1061128383_1061128387 3 Left 1061128383 9:128690259-128690281 CCGTCGCGCCAGCGTGCGGAGAA 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1061128387 9:128690285-128690307 TGGCGCCGCGACCAGTGTATCGG 0: 1
1: 0
2: 0
3: 0
4: 11
1061128383_1061128390 6 Left 1061128383 9:128690259-128690281 CCGTCGCGCCAGCGTGCGGAGAA 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1061128390 9:128690288-128690310 CGCCGCGACCAGTGTATCGGGGG 0: 1
1: 0
2: 0
3: 0
4: 7

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061128383 Original CRISPR TTCTCCGCACGCTGGCGCGA CGG (reversed) Intronic