ID: 1061129966

View in Genome Browser
Species Human (GRCh38)
Location 9:128703132-128703154
Sequence ACTGATTTGGAGACTGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061129966_1061129974 23 Left 1061129966 9:128703132-128703154 CCTTGCACAGTCTCCAAATCAGT 0: 1
1: 0
2: 1
3: 15
4: 213
Right 1061129974 9:128703178-128703200 CCCCAACCAGCCCGTGAGCGAGG No data
1061129966_1061129977 27 Left 1061129966 9:128703132-128703154 CCTTGCACAGTCTCCAAATCAGT 0: 1
1: 0
2: 1
3: 15
4: 213
Right 1061129977 9:128703182-128703204 AACCAGCCCGTGAGCGAGGACGG No data
1061129966_1061129969 -8 Left 1061129966 9:128703132-128703154 CCTTGCACAGTCTCCAAATCAGT 0: 1
1: 0
2: 1
3: 15
4: 213
Right 1061129969 9:128703147-128703169 AAATCAGTCCGCGGCTGACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061129966 Original CRISPR ACTGATTTGGAGACTGTGCA AGG (reversed) Intronic
900667170 1:3823337-3823359 ACTGCTCTTGAGCCTGTGCAAGG - Intronic
901081033 1:6584379-6584401 ACTGCTTTGGAGTCCCTGCAAGG + Intronic
901721328 1:11200513-11200535 ACTGTTCTGGTGACTGTGCGGGG + Intronic
903399700 1:23032776-23032798 AAATATTTGGACACTGTGCAGGG + Intronic
903409603 1:23130652-23130674 ATTAATTTGGGGACTGAGCATGG - Intronic
904450713 1:30609610-30609632 CCTGATTTGGAGCCAGTCCAGGG + Intergenic
904463037 1:30691721-30691743 ACTGACTTGGCACCTGTGCATGG - Intergenic
904791806 1:33028171-33028193 AGTGATTTAGAGTCTGTGAATGG - Intronic
906111777 1:43328717-43328739 ACTGATTTGTACACTTTACATGG + Intergenic
906691066 1:47793000-47793022 ACAGCTTTGAGGACTGTGCAGGG - Intronic
907725050 1:57012303-57012325 AATGAGTTGGACACTGTGCTAGG + Intronic
908969900 1:69815551-69815573 GCTGTTTTGGGGACTGTGAAGGG - Intronic
911292571 1:96075510-96075532 ACTGAATTGGAGATTCTGCAAGG - Intergenic
913196783 1:116463487-116463509 TCTGATTTAGAGAATGTGCGGGG + Intergenic
914421961 1:147537448-147537470 CCTGATTTGGGGGCTGTACAGGG - Intergenic
914450242 1:147785209-147785231 ACTGAGTTTGGGACTGTGCTAGG + Intergenic
917271023 1:173274539-173274561 ACAGTTTTGGGGATTGTGCAGGG - Intergenic
919807954 1:201391890-201391912 CCTGATTTGCAGACAATGCAGGG - Intronic
920448291 1:206037016-206037038 ACAGATTTCTAGATTGTGCAAGG + Intergenic
923447890 1:234089494-234089516 ACTGATGTGAAGACACTGCAGGG - Intronic
1065313137 10:24435575-24435597 ACTGTCTTGCAGCCTGTGCAAGG + Intronic
1065495744 10:26325740-26325762 ACAGATTTGAACTCTGTGCAGGG + Intergenic
1065988205 10:30978594-30978616 ACTGATCTGGAGGCAGTACAAGG - Intronic
1066523655 10:36251639-36251661 ACTGATTTGGGGAATCTGGAAGG - Intergenic
1070740583 10:78900540-78900562 ACAGCTTTGGGGGCTGTGCAGGG + Intergenic
1072496418 10:95964821-95964843 ACTGAACTGGAGACTTTGAATGG - Intronic
1072858311 10:98973998-98974020 AATGATTTGTAGGCTGGGCATGG + Intronic
1074757563 10:116636409-116636431 ACTTATTTGGATACTCTGCAGGG + Intronic
1075877569 10:125820791-125820813 AGTGGTTAGGAGACTGAGCATGG - Intronic
1076012159 10:126998082-126998104 TCTGCTTTTGAGACTGTGTATGG - Exonic
1080886141 11:36369885-36369907 ACTGAGTTGCAGGCTGGGCATGG - Intronic
1081491541 11:43573165-43573187 ACTGATGTGGAACCTGTCCAAGG - Intronic
1084860345 11:72013997-72014019 AGTGCTCTGGAGACTCTGCAGGG - Exonic
1086207758 11:84280550-84280572 ACTGATTTTTAAAGTGTGCAAGG + Intronic
1087287223 11:96278014-96278036 ACAGAATTGGAGACTGGGGATGG - Intronic
1087554233 11:99694452-99694474 ACTTACTTGAAGACTGTGCTTGG - Intronic
1089632034 11:119789847-119789869 ACTGAGCTGGAGACTGTGGTGGG - Intergenic
1090335314 11:125958472-125958494 ACTGTTTGGGTGCCTGTGCAGGG + Exonic
1093390153 12:18608884-18608906 ATAGATTTGGATTCTGTGCAGGG + Intronic
1093603794 12:21064846-21064868 ACTGATATGGAGGCGGTGGAAGG + Intronic
1095634071 12:44410684-44410706 ACTGATCAGGAGACTGGGCATGG + Intergenic
1096543271 12:52320503-52320525 AGTGATTTGGCCACTGAGCAGGG - Intronic
1097743958 12:63278629-63278651 CCTCATTTGGAGACAGTGAAAGG + Intergenic
1100302809 12:93323760-93323782 ACTGTGTTGGAGATTGTGCCAGG + Intergenic
1100688111 12:97009014-97009036 ACTGATCTGGAGGCTCTGTATGG + Intergenic
1102770806 12:115474345-115474367 ACTCATTTGGAGGCTGGGCACGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105821880 13:24087300-24087322 AATGCTTTGCAGAGTGTGCAGGG - Intronic
1107415486 13:40196100-40196122 ACAGATTTGGAGAAAATGCAGGG + Intergenic
1109202439 13:59445936-59445958 ACTCATTTGAAGACTTTGGATGG - Intergenic
1111010271 13:82303869-82303891 ACTTATTTCGAGACTGTGACTGG - Intergenic
1111411096 13:87877676-87877698 ACTGAAAATGAGACTGTGCATGG - Intergenic
1112380461 13:98884010-98884032 AGTGACTTGGCGACTGTGCCGGG + Intronic
1112598009 13:100827299-100827321 ACTACTCTGGAGACTGTGGAGGG + Intergenic
1112613752 13:100982093-100982115 ACAGTTTTGGAGACTGTGCGGGG - Intergenic
1118640849 14:67790813-67790835 ACTGATTTAGGGAATGTCCATGG + Intronic
1119231163 14:72980909-72980931 ACTGAATTAGAAACTGTGGAGGG + Intronic
1119275113 14:73348377-73348399 TCTGCTTTAGAGACTGTGCAGGG - Intronic
1120120061 14:80668103-80668125 ACTGTTGTGGGGATTGTGCAAGG - Intronic
1122496791 14:102162720-102162742 ACTGTTTGGGAGACTGTGGGAGG - Intronic
1124342042 15:28895820-28895842 TCTGATTTGAAGGCTGGGCATGG + Intronic
1124981809 15:34574592-34574614 TCTGATTTGAAGGCTGGGCACGG - Intronic
1127109266 15:55650342-55650364 ACTTACTTGGAGAGTGGGCAGGG + Intronic
1128337248 15:66794970-66794992 ACCAATTTTGAGACTGGGCATGG + Intergenic
1128733803 15:70039169-70039191 AATGATTTTGTGAGTGTGCAGGG - Intergenic
1133864137 16:9626055-9626077 ACTTTTTGGGAGACTGTGCTGGG + Intergenic
1135975906 16:27108987-27109009 ACTGGTGCGGAGCCTGTGCAAGG + Intergenic
1138493105 16:57388407-57388429 CCTAATTTGGAGGCAGTGCAGGG - Intergenic
1140492328 16:75348240-75348262 ACTATTTTGGAGACTGAGGAGGG - Intronic
1141268434 16:82517907-82517929 AAAGATTTGCAGAATGTGCAGGG + Intergenic
1141713868 16:85716071-85716093 AGGGGTTTGGAGACTGAGCAGGG - Intronic
1141890432 16:86923107-86923129 AGAGTTTTGGAGGCTGTGCATGG - Intergenic
1149269068 17:54956795-54956817 CCTGCTTTGGAGACTATGCCCGG - Intronic
1149377037 17:56054619-56054641 ACTTAATTGCAGACTGAGCATGG + Intergenic
1151793721 17:76327836-76327858 ACACATTTGTAGACTGTGTATGG - Intronic
1153286793 18:3463924-3463946 AATAATTTGGAGGCTGGGCACGG - Intergenic
1153349636 18:4064657-4064679 ACTGATTATGAGTCTGTTCAGGG - Intronic
1154907306 18:20592641-20592663 ACTCTTTTGGAGAATATGCAAGG - Intergenic
1154907408 18:20594344-20594366 ACTCTTTTGGAGAATATGCAAGG - Intergenic
1154914793 18:20709910-20709932 ACTCTTTTGGAGAATATGCAAGG + Intergenic
1154916555 18:20736549-20736571 ACTCTTTTGGAGAATATGCAAGG + Intergenic
1156991226 18:43410349-43410371 AAGAATTTGGAGACTGGGCATGG - Intergenic
1157772566 18:50362172-50362194 AGTGACTTAGAGACTGGGCATGG - Intergenic
1158496234 18:57957366-57957388 ACTGATTAGGTGACTTTTCAAGG + Intergenic
1159034592 18:63264572-63264594 AGTAATTTGGAGACAGTGCAGGG - Intronic
1159840285 18:73391276-73391298 GCTGATTTGGAGAATATGGATGG - Intergenic
1160036585 18:75307284-75307306 AATGATTTGGTGGCTGGGCATGG + Intergenic
1161031540 19:2059993-2060015 ACTTCCTTGGGGACTGTGCAGGG - Intergenic
1166128980 19:40734235-40734257 ACTGTTTTTGTGACTGTGCCTGG + Intronic
927811580 2:26183336-26183358 TCTGACTTGGAGACTTTTCAGGG + Intronic
927953042 2:27186925-27186947 TCTGATTTGGAGACTGGCAAAGG - Intergenic
929844697 2:45511115-45511137 ACTGAATTGCAGGCTGTACAAGG + Intronic
929880610 2:45833951-45833973 ACTAATGTGGAGAGTGTGTAAGG - Intronic
931986420 2:67746663-67746685 ACTGATTCAGAGACAGTGAAGGG - Intergenic
933351249 2:81154691-81154713 ACTTTTTTGGGGAATGTGCAGGG + Intergenic
935586268 2:104802558-104802580 ACTGATTTGGATTCTGTTCTTGG - Intergenic
938205609 2:129419769-129419791 GCTGACTCGGAGACTCTGCATGG - Intergenic
938426307 2:131192313-131192335 ACTGAATTGGACACTTTGAATGG + Intronic
938726617 2:134114309-134114331 ACGCATTTGGAAACTGAGCAAGG + Intergenic
940634263 2:156278298-156278320 GATGATTTGGAGAATGTGCTTGG - Intergenic
942505925 2:176641721-176641743 ACAGATTGGGAGGCAGTGCAGGG - Intergenic
947104498 2:226654465-226654487 ACTTATTTGGATATTGTGCCAGG + Intergenic
1168780826 20:488293-488315 ACTGATGTGCAGGCTGGGCACGG - Intronic
1173556090 20:43966857-43966879 AGTGATGTGGAGTCTCTGCAGGG + Intronic
1174066055 20:47866847-47866869 ACTGAGGTGGAGGCTGAGCAGGG - Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1179269432 21:39839234-39839256 AATGATTTGGAGACTGAGAGAGG + Intergenic
1179795813 21:43782635-43782657 ATTGATGTAGAGACTGTGCGTGG - Intergenic
1179901447 21:44396488-44396510 AGGGATGTGGAGACTGTGGAAGG + Intronic
1182759282 22:32708930-32708952 GCTGCTTTGGGGGCTGTGCACGG + Intronic
1182786251 22:32910093-32910115 AGTGAGTTGGAGACTGTGCCAGG - Intronic
1183199436 22:36375633-36375655 GCAGATGGGGAGACTGTGCAGGG - Intronic
1183680820 22:39328227-39328249 CCTGTCCTGGAGACTGTGCATGG + Intergenic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184296326 22:43527655-43527677 CCTCATTTGGACCCTGTGCAGGG + Intergenic
949141051 3:633640-633662 ACTGATTTGGAGCCTCTGTTGGG - Intergenic
949737092 3:7185840-7185862 CATGATTTGGAGACTTTGAAGGG - Intronic
950805024 3:15594115-15594137 ACTGAATTTGAGGCTGAGCACGG + Intronic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951465752 3:22998791-22998813 ACAGGTTTGGACACTGTGAAAGG - Intergenic
951599900 3:24362213-24362235 ACAGCTTTGCAGACTGTGAAAGG - Intronic
952965244 3:38617015-38617037 ACTGATTTAGAGGCTGTGGGAGG - Intronic
953847590 3:46440130-46440152 ACTGAATTGTACACTTTGCATGG + Intronic
954342291 3:49964514-49964536 ACTCATTTGCAGATTGTGTATGG + Intronic
955375940 3:58397398-58397420 ACTGATTGGAAAACTGTGGAGGG + Intronic
957215325 3:77313532-77313554 ACTGATCTAGAGACTGGGAATGG - Intronic
957506257 3:81125287-81125309 GGTGATTTGGAGACCCTGCAAGG + Intergenic
960027327 3:113024025-113024047 ACTGAGTTTGAGATTGTCCATGG + Intergenic
961056428 3:123792878-123792900 ACTGAATTGCATGCTGTGCATGG - Intronic
961289129 3:125831313-125831335 ACAGTTTTGTAGACTGTACAGGG + Intergenic
961684278 3:128618509-128618531 AGGGATTAGGAGATTGTGCAGGG - Intergenic
962076564 3:132088461-132088483 ACAGCCTTGGAGACTGTGGATGG + Intronic
965468421 3:169060845-169060867 ACAGATCTGGAAACTGGGCAAGG + Intergenic
965932282 3:174059580-174059602 ACTGATATGGAGACTTTTCTTGG + Intronic
966305066 3:178522442-178522464 ACTGATTTCGAGGCTGTCAAGGG - Intronic
967021141 3:185524010-185524032 GCATATTTGGAGGCTGTGCATGG - Intronic
968421800 4:491135-491157 ACTGATTTTGGGGCTGGGCATGG + Intronic
969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG + Intronic
969177247 4:5408024-5408046 ACAGATTTGGTGTCTGTGGAGGG - Intronic
970777123 4:19688415-19688437 ATTAATTTGGAGAGTGTTCAAGG + Intergenic
971888603 4:32486177-32486199 GCTGTTTTGGGGACTGTGCAGGG - Intergenic
972897578 4:43642922-43642944 ACTGATTGGGAGAGGGTTCATGG + Intergenic
978535215 4:109755042-109755064 ACTAATTTGTAGACTGTAAAAGG + Intronic
979027520 4:115596381-115596403 ACTGATTGGGAGGTTGAGCAAGG + Intergenic
979568270 4:122182399-122182421 GATGATTTGGAAACTGTGTATGG - Intronic
980404303 4:132336682-132336704 AATTATTGGGAGACTGGGCATGG - Intergenic
980569849 4:134600440-134600462 ACAGATTTGCAGAGTGAGCAGGG + Intergenic
982233467 4:153230482-153230504 ACTGGTTTTGAGACTGAACATGG - Intronic
983352203 4:166604086-166604108 ACCCATTAGGAGACTGGGCATGG + Intergenic
984041344 4:174738080-174738102 ATTGATTTGGAGATTGGCCAAGG + Intronic
985684069 5:1272526-1272548 TCTGATGTGGTGACTGTGGATGG - Intronic
985684076 5:1272560-1272582 TCTGATGTGGTGACTGTGGATGG - Intronic
985684082 5:1272594-1272616 TCTGATGTGGTGACTGTGGATGG - Intronic
985684117 5:1272772-1272794 TCTGATGTGGTGACTGTGGATGG - Intronic
985684131 5:1272842-1272864 TCTGATGTGGTGACTGTGGATGG - Intronic
985684191 5:1273141-1273163 TCTGATGTGGTGACTGTGGATGG - Intronic
985684219 5:1273283-1273305 TCTGATGTGGTGACTGTGGATGG - Intronic
985684233 5:1273353-1273375 TCTGATGTGGTGACTGTGGATGG - Intronic
985684272 5:1273541-1273563 TCTGATGTGGTGACTGTGGATGG - Intronic
985684279 5:1273575-1273597 TCTGATGTGGTGACTGTGGATGG - Intronic
985684304 5:1273686-1273708 TCTGATGTGGTGACTGTGGATGG - Intronic
985684311 5:1273720-1273742 TCTGATGTGGTGACTGTGGATGG - Intronic
987127559 5:14828769-14828791 TCTGATTTGGATATAGTGCAAGG - Intronic
990421275 5:55636898-55636920 AATGATTTTGAAACTGTGCCCGG - Intronic
991126712 5:63077896-63077918 ACTGGTTGGGAAACTGGGCAAGG + Intergenic
993212191 5:84965980-84966002 ACTGATTTGGGGACAGAGTAGGG - Intergenic
993216374 5:85027721-85027743 CCTGATTGGGAAACTGGGCAGGG + Intergenic
993589433 5:89776736-89776758 ACTCATTAGTAGACTGAGCATGG + Intergenic
994835192 5:104843291-104843313 ACTGACTTTGAGACGGAGCAGGG + Intergenic
995905640 5:117119292-117119314 ACTGATTTGCACACTATCCAAGG - Intergenic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
997826578 5:137111961-137111983 CCTTATTTGGGGCCTGTGCAGGG + Intronic
999914180 5:156239107-156239129 TCAGATTTGGAGGCTGGGCATGG + Intronic
1001701023 5:173706467-173706489 ACTGACTTGGACACTGTTCCTGG - Intergenic
1002206890 5:177569146-177569168 CCTGAGTTGCAGACAGTGCAGGG - Intergenic
1005457718 6:26037238-26037260 ACTGATTTGGAGCGTGTTCAAGG - Intergenic
1006809769 6:36812305-36812327 GCTGATGTGGAGACTGTACAGGG + Intronic
1007243682 6:40444797-40444819 ACTGAGAGGGAGACTGTGCGGGG - Intronic
1007837958 6:44690603-44690625 ACTGATCTGAAGGCTGGGCATGG + Intergenic
1010178989 6:73062870-73062892 ACAGATTTGGAGTCTGTGGTAGG - Intronic
1012547177 6:100433139-100433161 ACTGGTTTGGAGAGTATGGATGG - Intronic
1014678704 6:124400824-124400846 ACTGATTAGGAGAGTGAGCATGG - Intronic
1014773494 6:125483321-125483343 ACTGATTTTGAGTCATTGCAGGG + Intergenic
1017744107 6:157431503-157431525 TCTGTTTTGGAGACTGAGGATGG + Intronic
1020508781 7:9025715-9025737 ATTGATTTGCAGAGGGTGCATGG - Intergenic
1023504670 7:40887295-40887317 ACATATTTGGAGACTGTGTTGGG + Intergenic
1023878436 7:44305563-44305585 ACTGTTTTTGAGCCAGTGCAGGG - Intronic
1024607575 7:51034944-51034966 ACGGAGTTGGGGACTCTGCAGGG + Intronic
1025679772 7:63672733-63672755 ATGGCTTTGGAGACTGGGCAGGG - Intergenic
1028806779 7:95036854-95036876 ACTGAGTTGGATAGTGTGTATGG - Intronic
1030503416 7:110388004-110388026 AATGATTTGGAGACTAGGGAAGG + Intergenic
1030635583 7:111944809-111944831 ACCGATTCGGATAATGTGCACGG + Exonic
1030877109 7:114827445-114827467 GCTGATTTGGAGAATGTGTGTGG - Intergenic
1032287075 7:130547034-130547056 ACTTATTTGGAGACTTGGGAAGG - Intronic
1032895027 7:136240828-136240850 ACTGTTTTGGAGGCTGTCCTTGG + Intergenic
1036397416 8:8381169-8381191 TGTGATTTGCAGACTGTGTAGGG - Intronic
1038341688 8:26691461-26691483 ACTGTGTTGGAGACTGTTGAAGG + Intergenic
1039731119 8:40279828-40279850 ACTTATTTGTAGACTGGACATGG - Intergenic
1041145431 8:54871084-54871106 ACTGATTTAGACACAGTTCAAGG - Intergenic
1041344321 8:56880298-56880320 TAAGATTTGGAGACTGAGCATGG + Intergenic
1043595637 8:81881752-81881774 ACTGATGTGGACACAGTGTAGGG + Intergenic
1044407906 8:91851295-91851317 AGGCATTTGGAGACAGTGCAGGG + Intergenic
1047126394 8:121966191-121966213 ACAGATTTGGTAACTGTGCTTGG - Intergenic
1047608255 8:126495980-126496002 ACTGATATGCATACTCTGCATGG - Intergenic
1049076035 8:140396756-140396778 ACTGACTTAGAGACTGTCCCTGG + Intronic
1049466913 8:142755592-142755614 TCTGTTTTGGAGTCTGGGCACGG + Intergenic
1049711417 8:144065273-144065295 GCTGATTTGTAGACTGTCCTGGG + Intergenic
1049769998 8:144375337-144375359 ACAGATTGGGAGTCTGGGCAGGG - Intronic
1050020554 9:1280089-1280111 ACTGCATTGGAAGCTGTGCAGGG + Intergenic
1050662313 9:7895905-7895927 ATTCAGTAGGAGACTGTGCAGGG - Intergenic
1050895511 9:10881268-10881290 ACTGAATTGCAGACAGTCCAAGG + Intergenic
1058261824 9:102842921-102842943 ACCGATTTGCAGTCTGTGCATGG + Intergenic
1058868037 9:109179683-109179705 TCTGATTTGCAGAATGTGGATGG - Intronic
1059494065 9:114694914-114694936 CCTGGCTTGGAGACTGCGCATGG + Intergenic
1061129966 9:128703132-128703154 ACTGATTTGGAGACTGTGCAAGG - Intronic
1061532287 9:131224022-131224044 AGTGATTTGGGGGCTGGGCATGG - Intronic
1187128971 X:16482436-16482458 ACTGAGTAGGATACTGTGCTTGG - Intergenic
1188183056 X:27079274-27079296 ACTTATTTGGTGAGTGTGTAAGG + Intergenic
1188712310 X:33415777-33415799 ACTTGTTTGGGCACTGTGCACGG + Intergenic
1191266866 X:58404813-58404835 ACTGTTTTGTAGAATCTGCAAGG + Intergenic
1197249505 X:124200201-124200223 ACAGATTGGGAGACTGAGGAGGG + Intronic
1197907147 X:131437692-131437714 ACTGCCTTGGAGACTGTGGCTGG + Intergenic
1197943645 X:131815375-131815397 ACTGATGTGGACACTGAGAATGG + Intergenic
1200015525 X:153159772-153159794 ACTGTATTAGATACTGTGCAAGG - Intergenic
1200820750 Y:7580368-7580390 ACTACTTGGGAGACTGAGCAAGG + Intergenic
1202175271 Y:22093278-22093300 AGTCATTTTGAGACTGTGAAGGG + Intronic
1202216091 Y:22493105-22493127 AGTCATTTTGAGACTGTGAAGGG - Intronic
1202239556 Y:22752374-22752396 ACTACTTGGGAGACTGAGCAAGG - Intergenic
1202392543 Y:24386136-24386158 ACTACTTGGGAGACTGAGCAAGG - Intergenic
1202478241 Y:25283981-25284003 ACTACTTGGGAGACTGAGCAAGG + Intergenic