ID: 1061135515

View in Genome Browser
Species Human (GRCh38)
Location 9:128731234-128731256
Sequence CCTTCCGAGGGAGCCTCCCA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061135515_1061135522 -8 Left 1061135515 9:128731234-128731256 CCGTGGGAGGCTCCCTCGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1061135522 9:128731249-128731271 TCGGAAGGGGCCCGCCCGCTGGG 0: 1
1: 0
2: 0
3: 4
4: 51
1061135515_1061135521 -9 Left 1061135515 9:128731234-128731256 CCGTGGGAGGCTCCCTCGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1061135521 9:128731248-128731270 CTCGGAAGGGGCCCGCCCGCTGG 0: 1
1: 0
2: 0
3: 9
4: 115
1061135515_1061135527 23 Left 1061135515 9:128731234-128731256 CCGTGGGAGGCTCCCTCGGAAGG 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1061135527 9:128731280-128731302 GCATGCTTCCTCCCCGCCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061135515 Original CRISPR CCTTCCGAGGGAGCCTCCCA CGG (reversed) Exonic