ID: 1061135963

View in Genome Browser
Species Human (GRCh38)
Location 9:128733652-128733674
Sequence GGGGGCAGTGCTAGAAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061135945_1061135963 30 Left 1061135945 9:128733599-128733621 CCTGTCTGTGAGGACTATCCTGG 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1061135963 9:128733652-128733674 GGGGGCAGTGCTAGAAATGGGGG 0: 1
1: 0
2: 0
3: 27
4: 247
1061135952_1061135963 12 Left 1061135952 9:128733617-128733639 CCTGGTGTCGGGGGTGTGAAGGC 0: 1
1: 0
2: 0
3: 9
4: 139
Right 1061135963 9:128733652-128733674 GGGGGCAGTGCTAGAAATGGGGG 0: 1
1: 0
2: 0
3: 27
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061135963 Original CRISPR GGGGGCAGTGCTAGAAATGG GGG Intronic