ID: 1061137283

View in Genome Browser
Species Human (GRCh38)
Location 9:128742165-128742187
Sequence TGATAAATATCACTGGTGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061137283_1061137287 -2 Left 1061137283 9:128742165-128742187 CCTTTCACCAGTGATATTTATCA 0: 1
1: 0
2: 2
3: 23
4: 205
Right 1061137287 9:128742186-128742208 CATCTCCCCACTGGCCTCCAGGG No data
1061137283_1061137293 18 Left 1061137283 9:128742165-128742187 CCTTTCACCAGTGATATTTATCA 0: 1
1: 0
2: 2
3: 23
4: 205
Right 1061137293 9:128742206-128742228 GGGCCCATGCCAAGAAGTGCTGG No data
1061137283_1061137295 20 Left 1061137283 9:128742165-128742187 CCTTTCACCAGTGATATTTATCA 0: 1
1: 0
2: 2
3: 23
4: 205
Right 1061137295 9:128742208-128742230 GCCCATGCCAAGAAGTGCTGGGG No data
1061137283_1061137286 -3 Left 1061137283 9:128742165-128742187 CCTTTCACCAGTGATATTTATCA 0: 1
1: 0
2: 2
3: 23
4: 205
Right 1061137286 9:128742185-128742207 TCATCTCCCCACTGGCCTCCAGG No data
1061137283_1061137294 19 Left 1061137283 9:128742165-128742187 CCTTTCACCAGTGATATTTATCA 0: 1
1: 0
2: 2
3: 23
4: 205
Right 1061137294 9:128742207-128742229 GGCCCATGCCAAGAAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061137283 Original CRISPR TGATAAATATCACTGGTGAA AGG (reversed) Intronic
902102347 1:14001732-14001754 TGATAAAAAGCAATGGGGAAAGG + Intergenic
905663018 1:39742857-39742879 TGATGAATATGTTTGGTGAATGG - Intronic
906626041 1:47326594-47326616 TGATAAATAGGATTGATGAATGG + Intergenic
907467140 1:54646017-54646039 TCATAAATATCACTGGAGACCGG - Intronic
908191542 1:61708585-61708607 TGATAAATATGGATGATGAATGG - Intronic
910122647 1:83807656-83807678 TCATAAATATCACTGCAGAGTGG + Intergenic
911808110 1:102236514-102236536 GCATAAATATCCCTGGTGCAAGG + Intergenic
912337750 1:108878140-108878162 TGATAAATACCACTTTTGATTGG + Intronic
916387029 1:164285649-164285671 TGTTGAAAATCAATGGTGAAGGG - Intergenic
916409572 1:164532431-164532453 TGTTAAAGTTCACTGGAGAAGGG - Intergenic
917001279 1:170363311-170363333 TGATGAATAGAAGTGGTGAAAGG + Intergenic
917273413 1:173303690-173303712 TGATGATTATCTCTGGGGAAAGG - Intergenic
917474964 1:175361663-175361685 TGCTTAATTTCACTGGAGAATGG - Intronic
917772319 1:178293226-178293248 TGATAAATAACACAAGTAAATGG + Intronic
919041452 1:192393508-192393530 TGAAGACTATGACTGGTGAAGGG + Intergenic
919448741 1:197744235-197744257 TGAAAAATCTCTTTGGTGAATGG - Intronic
920654661 1:207866764-207866786 TGATAAAGAAGACTGGGGAAAGG + Intergenic
921156522 1:212443329-212443351 TGATAACAAACACTGCTGAATGG + Intronic
921541302 1:216419295-216419317 TGTTAAATATCTGAGGTGAAAGG + Intronic
921648243 1:217645560-217645582 TGTTAAATATTAATGGTAAAAGG + Intronic
921904081 1:220477879-220477901 TCATCACTATCACTGGTGAATGG - Intergenic
922126493 1:222730642-222730664 TGATAAATTTCAGTTGTGTAGGG + Intronic
924773912 1:247101922-247101944 TCATAAATAGCACTGATGATAGG + Intronic
1065960437 10:30729871-30729893 TGATAAAGATCACTCATGAAGGG + Intergenic
1066630169 10:37451640-37451662 TGCTCAATATCACTGATAAAGGG - Intergenic
1069154303 10:65006621-65006643 TGTTGAATAGCACTGGTGAAAGG + Intergenic
1069565191 10:69459371-69459393 AAATAAATATCACTTGTGATAGG + Intronic
1070538618 10:77399674-77399696 CTATAAAAAGCACTGGTGAATGG + Intronic
1072006670 10:91257206-91257228 TGCTAAATATCACTAGTCACTGG + Intronic
1072754551 10:98010349-98010371 TAATAATTATCAATGGTGATTGG + Intronic
1072812682 10:98475503-98475525 GGATCAATAGAACTGGTGAATGG + Intronic
1073498370 10:103914840-103914862 GGTTAAATTTCACAGGTGAAGGG + Intronic
1074111923 10:110428877-110428899 TAATAAAAATCACTGCTGCAAGG - Intergenic
1074338534 10:112603354-112603376 TGCTATATATCAATGGTCAAGGG - Intronic
1074485402 10:113872294-113872316 TGATGAATAGCATTGGTGTAAGG - Intronic
1074820277 10:117173329-117173351 GGATGAAAATCACTGATGAAGGG + Intergenic
1080039947 11:27748954-27748976 TGATCAATATTAATGTTGAAGGG - Intergenic
1082724169 11:56715248-56715270 TGAGAATTATCATTGTTGAAAGG - Intergenic
1083012154 11:59412587-59412609 TGATAGATACCACAGATGAAAGG + Intergenic
1084303894 11:68269047-68269069 TAATGAATATCCCTGGGGAATGG + Intronic
1085089383 11:73697278-73697300 GGATAAAGAATACTGGTGAAGGG - Intronic
1085571633 11:77563763-77563785 TGTTGAATAGCAGTGGTGAAAGG + Intronic
1086147735 11:83571677-83571699 TGAGAAATATTACTGATGAGCGG + Intronic
1086549416 11:88038456-88038478 TGATAAATAAAACTGTTAAATGG - Intergenic
1086755966 11:90562347-90562369 AGAATTATATCACTGGTGAAGGG - Intergenic
1088063067 11:105680719-105680741 TGAGAAACCTCACTGGGGAAGGG - Intronic
1088610789 11:111574472-111574494 TGACAACTATCAATTGTGAAAGG + Intergenic
1088783899 11:113163549-113163571 TGAGACATCTCTCTGGTGAATGG + Intronic
1090143153 11:124287872-124287894 TGATAAAAATGAGTGGTGAGAGG + Intergenic
1092677238 12:10934413-10934435 GGATTCATAACACTGGTGAACGG - Intronic
1095515745 12:43003399-43003421 TGATAAACATGCCTTGTGAAAGG + Intergenic
1096889608 12:54755500-54755522 TGTTAAATAAAACTTGTGAAAGG + Intergenic
1097915180 12:65013650-65013672 TGATAAATACCACTGGTTGATGG - Intergenic
1098816755 12:75175341-75175363 AGATAAATATCATTAGGGAATGG + Intronic
1099149113 12:79086712-79086734 TGTCAAATATCATTGGTGCAAGG + Intronic
1099767301 12:87004019-87004041 TGTTAAATAGGAGTGGTGAATGG + Intergenic
1100654850 12:96631546-96631568 TTATTAATTTCACTGCTGAATGG + Intronic
1104647007 12:130504851-130504873 TGATTGATATGACTGGGGAAGGG - Intronic
1107020937 13:35750750-35750772 TGTTGAATAACAGTGGTGAAAGG + Intergenic
1109748832 13:66663286-66663308 CAATAAATATTAATGGTGAAAGG - Intronic
1109870031 13:68322025-68322047 TGATCAAAGTTACTGGTGAATGG - Intergenic
1110343253 13:74416751-74416773 TGATAAATATCACTGGTCATTGG + Intergenic
1116134160 14:40899464-40899486 TGATAAATCTCACTTGTTCATGG + Intergenic
1116275392 14:42825913-42825935 TGTTGAATAACAGTGGTGAAAGG + Intergenic
1116584545 14:46686286-46686308 TGAAAAATACAACTGATGAAGGG - Intergenic
1116699423 14:48220741-48220763 AGAGAAATATGACTGGCGAAAGG - Intergenic
1117506851 14:56413001-56413023 TGATAAAGAACACCGGAGAAGGG - Intergenic
1119792497 14:77365064-77365086 GGATAAATATCATTGTTGAGTGG - Intronic
1120576198 14:86184023-86184045 TGATAAATACCAAAGGTGAATGG - Intergenic
1120601755 14:86519455-86519477 TGATAAAAATCAGTGGGCAAAGG - Intergenic
1124357419 15:29006039-29006061 TGTTAAATAGAAGTGGTGAAAGG - Intronic
1124589169 15:31037944-31037966 TGAGAAATCTCACTGGTTAAAGG - Intronic
1124621618 15:31277291-31277313 TGACAAAGAGCACTGGTGAGGGG - Intergenic
1125144329 15:36449055-36449077 TGAAATATATCACTGGTACATGG + Intergenic
1126194001 15:45911267-45911289 TGAAAAATATCACTATTGAAAGG - Intergenic
1130877981 15:88030805-88030827 TGATAAATATGACAGATGACAGG - Intronic
1131814017 15:96203679-96203701 TTATAAACATAAATGGTGAAAGG + Intergenic
1134863308 16:17580677-17580699 TGTTGAATACCATTGGTGAAAGG - Intergenic
1136650898 16:31669508-31669530 TTTTAAATAACAGTGGTGAATGG + Intergenic
1137369682 16:47893786-47893808 TCATAAATCTCACTTGTGATGGG + Intergenic
1140180437 16:72711264-72711286 TGAAAAATATCACAGGTTAATGG - Intergenic
1144425625 17:15138622-15138644 TGATATATATGATTGGTTAATGG + Intergenic
1152419748 17:80186029-80186051 TGATAAATATCTCGGGTGTGGGG + Intronic
1154032206 18:10763741-10763763 AGATAAATGTAACTGATGAATGG + Intronic
1154342477 18:13515540-13515562 AGATGTATAGCACTGGTGAAAGG + Intronic
1155821525 18:30383625-30383647 TTATAAAGATCACTGGTGGCTGG - Intergenic
1156021391 18:32603339-32603361 TGTTAAATAACAGTAGTGAAAGG + Intergenic
1158604558 18:58883817-58883839 TGCTAAATATAATTGGTGATAGG + Intronic
1159507610 18:69357122-69357144 TGTTACATCTCACTGGTGAAGGG - Intergenic
1160112291 18:76045027-76045049 TGAAAAATGTCACTGGTAATTGG + Intergenic
1162239928 19:9342902-9342924 TGAGAACTCACACTGGTGAACGG + Exonic
1162693676 19:12454583-12454605 TGATGAATAGCAGTGGTGAGAGG + Intronic
1164792012 19:30995260-30995282 TAATCAATATTAATGGTGAAAGG - Intergenic
1168605439 19:57755859-57755881 TCAAAAATACCACTGCTGAATGG - Exonic
927940577 2:27100788-27100810 TGATTAATATTACTGGGGATGGG + Exonic
928803261 2:35119938-35119960 TGCTGAATATCAATGGTGAAAGG - Intergenic
929276364 2:40029627-40029649 ACATAAAGATCAATGGTGAATGG - Intergenic
930738970 2:54809904-54809926 TGATACATGTCACTGCTGAAAGG + Intronic
932513628 2:72322175-72322197 TCATAAATGTCAAAGGTGAATGG + Intronic
933010127 2:77051267-77051289 TGGTAAATATCTCTAGTGCAGGG - Intronic
936069863 2:109359800-109359822 AAATAAATATCACAGCTGAAGGG - Intronic
936501378 2:113069501-113069523 TTTTGAATATCACTGGTGAGAGG + Intronic
936551497 2:113446051-113446073 TGATAAATCTGACTGATGATAGG + Intronic
939505647 2:143043535-143043557 TGATAAATATCAGTAGTTACTGG - Exonic
941540584 2:166778719-166778741 TGTTAAATACCACTGGCAAATGG - Intergenic
941990669 2:171553825-171553847 TGATAACTGTTACTGGTGGAGGG + Intronic
943142769 2:184003105-184003127 TGTTGAATAAAACTGGTGAAAGG - Intergenic
948322689 2:237083211-237083233 TGATACATATCACAGGTTAGAGG - Intergenic
1170087177 20:12546714-12546736 ATATAAAAATCACTGGTAAATGG - Intergenic
1170455321 20:16527509-16527531 TGACAAATATCAAAGGAGAAAGG + Intronic
1175439357 20:58980118-58980140 TGACAAAAATCTCTGGAGAAAGG - Intergenic
1178238170 21:30868085-30868107 TGAGAAATAACAAAGGTGAATGG - Intergenic
1180034707 21:45239568-45239590 TGTTGAATAACAGTGGTGAAAGG - Intergenic
950730956 3:14956988-14957010 TGGTAGCTATCATTGGTGAAAGG - Intronic
952021177 3:29022789-29022811 TAAGAAATAACATTGGTGAAGGG - Intergenic
952401582 3:32968353-32968375 TGAAAAAAAACACTGGTCAAGGG + Intergenic
952544132 3:34400346-34400368 AGATAAATATTTCTGGTGACTGG + Intergenic
953347106 3:42185399-42185421 TGATGGATATCAATGGTGAGAGG + Intronic
955040742 3:55315456-55315478 TGATTACTATGACTGTTGAAGGG + Intergenic
962360302 3:134736308-134736330 TGTTAAATAAAAGTGGTGAATGG - Intronic
963454513 3:145527219-145527241 TGTTGAATAACAGTGGTGAAAGG - Intergenic
965527751 3:169739669-169739691 TGCTAAATATTACTAGTTAATGG - Intergenic
965538566 3:169850065-169850087 TGATAAAAAACACTGGTGAGAGG - Intronic
967366709 3:188694926-188694948 TGTTAAATCTCACTGGCAAAAGG + Intronic
967514488 3:190350540-190350562 TGAAAAATATCACAGGTAAAGGG + Intronic
970359634 4:15295971-15295993 TGATAAAAATCAGTGCTCAAGGG + Intergenic
971354389 4:25881780-25881802 TTATACATATCACTGTTGATGGG - Intronic
972028688 4:34422873-34422895 TGATCATGCTCACTGGTGAACGG + Intergenic
972108286 4:35521756-35521778 TGATAACTGTCATTGGTGAAAGG - Intergenic
972149737 4:36074438-36074460 TTATACATATGACTGGAGAAAGG + Intronic
972942288 4:44211042-44211064 GGATAAACAGAACTGGTGAAAGG - Intronic
973651607 4:53002453-53002475 TGCTTAATATCACTGGGGAAGGG + Intronic
979360482 4:119758216-119758238 TGATATGTATCACTTCTGAAAGG + Intergenic
979395440 4:120182551-120182573 TGTTGAATAACAGTGGTGAAAGG - Intergenic
979472916 4:121122628-121122650 TGATAAATATAGCTGGTTAATGG - Intergenic
981163562 4:141529346-141529368 TGTTAAATAGAAGTGGTGAAGGG - Intergenic
981417734 4:144512757-144512779 TGATAACAATCACTGTTGACAGG - Intergenic
982361249 4:154521766-154521788 TGATAAATTTCACTGTGGACTGG + Intergenic
982812651 4:159845747-159845769 TGATAAAAATCATAGGTAAAAGG - Intergenic
983021346 4:162679393-162679415 TGTTAAATAGGAGTGGTGAAAGG - Intergenic
983225263 4:165080601-165080623 TGAAAAATATCACATGGGAATGG + Intronic
983344051 4:166503146-166503168 AGATAAATGTTACTAGTGAATGG - Intergenic
984042768 4:174757017-174757039 TGCTAAATAACAATGGAGAATGG - Intronic
984405290 4:179321169-179321191 TTATAAAAATCACTAGAGAAAGG + Intergenic
984844174 4:184095955-184095977 TGATAACTATCACTGGTTAAAGG + Intronic
987982111 5:25099144-25099166 TGATAAATAACACTGATTTAAGG + Intergenic
988474259 5:31568888-31568910 TGAAATTTATCAGTGGTGAAAGG + Intergenic
989491057 5:42054973-42054995 TAAGAAATATCACAGGAGAATGG - Intergenic
989500624 5:42162616-42162638 TGATAAATATTCAAGGTGAAGGG - Intergenic
989749727 5:44878915-44878937 TAAGAAATATCACTGGTAAGGGG + Intergenic
990419716 5:55619376-55619398 TGAGAAAGATCCTTGGTGAAAGG - Intergenic
991138995 5:63216868-63216890 TTATAAATATTACTTTTGAAAGG - Intergenic
992081483 5:73237483-73237505 TGATAAATATCTGTGGTAATGGG + Intergenic
992210704 5:74477218-74477240 TGGTCAATATCACTGGCCAAAGG + Intergenic
993430137 5:87822897-87822919 AGATAGATATCCCTGGGGAAAGG - Intergenic
993671410 5:90765162-90765184 TGATCAAAGTTACTGGTGAAAGG - Intronic
994848060 5:105016021-105016043 TGATAACAATCAATGGGGAAAGG + Intergenic
995932621 5:117466897-117466919 TGTTGAATAACAATGGTGAAAGG + Intergenic
998687045 5:144539815-144539837 TGCTAAATATAACTAGGGAATGG - Intergenic
999546256 5:152631860-152631882 TGCTAAGTATCACTGGTGGATGG - Intergenic
1002876164 6:1211603-1211625 TGCTGAATAGCACTGGTGATGGG - Intergenic
1003733040 6:8847316-8847338 TGGTAAATCTCAGTGGTGAGTGG + Intergenic
1003945207 6:11069302-11069324 AGACAAATACCACTGGTGCATGG - Intergenic
1005515050 6:26546444-26546466 TGTTACAAATCACTGGGGAAAGG - Intergenic
1005948009 6:30609078-30609100 TGACCAATATTTCTGGTGAACGG + Exonic
1006013188 6:31059435-31059457 TGATAAATAACCCTGGTGGATGG - Intergenic
1007165600 6:39826638-39826660 TGAAAAAAATCACTGGCAAAAGG - Intronic
1009027644 6:58018865-58018887 TGATAAACTTCAATGGTCAAGGG + Intergenic
1009203177 6:60770342-60770364 TGATAAACTTCAATGGTCAAGGG + Intergenic
1009448142 6:63767956-63767978 TGATAACAAGCACTGGGGAAAGG + Intronic
1009740868 6:67744543-67744565 TGAGAAGTATCAGTGGAGAATGG + Intergenic
1010054722 6:71551883-71551905 TGAAATATGTCACTAGTGAAGGG + Intergenic
1010388182 6:75306394-75306416 TGATAAAAATCACTGAAGAATGG + Intronic
1011055741 6:83201649-83201671 AGAGAAATAACACTGGTGAGGGG - Intergenic
1011198996 6:84814043-84814065 TGAAATATATTACTGGGGAAAGG + Intergenic
1012657258 6:101839813-101839835 TGATAAATATGACTGGAAATGGG + Intronic
1014054490 6:116997880-116997902 TCAAAATTATCACTGGAGAAAGG + Intergenic
1014140675 6:117938666-117938688 TGGTAATTCTCAGTGGTGAAGGG + Intronic
1015285680 6:131484325-131484347 TGATAAATAAAAGTGGTGAGGGG + Intergenic
1017811469 6:157986793-157986815 TGATAACTATCAATGCCGAATGG - Intronic
1018817002 6:167340699-167340721 TGATAAACATAAATGGTCAAAGG - Exonic
1018881306 6:167884283-167884305 GGAAAAATATCAATAGTGAAAGG - Intronic
1019843080 7:3468874-3468896 TGCTAAAAATCACTGATGAGAGG - Intronic
1022996478 7:35760744-35760766 TGATAAAAATCTCTGTCGAATGG + Intergenic
1023384816 7:39646034-39646056 TCAAAATTATCTCTGGTGAAAGG + Intronic
1023733139 7:43210844-43210866 CGGTAAATATCAATGGTGGACGG + Intronic
1024535201 7:50424633-50424655 TTAGAAATATCAGTGGGGAAAGG + Intergenic
1024969095 7:55052491-55052513 TGATTATTATCACTGTTGATTGG - Intronic
1026237352 7:68538872-68538894 TCATTAGTGTCACTGGTGAATGG - Intergenic
1026418266 7:70205805-70205827 TGATCAAGAGCACTGGTCAAAGG - Intronic
1026967687 7:74450819-74450841 TGGTAGATAACACTGGTGATTGG - Intergenic
1028246888 7:88490059-88490081 TGATAAATATCAATGAAGCAGGG - Intergenic
1028397811 7:90391645-90391667 TGATATCTATCCATGGTGAATGG + Intronic
1028961426 7:96753648-96753670 AGATAAAAATCACTGCTAAAAGG + Intergenic
1030556780 7:111035216-111035238 TGACCAATAACACTGGTAAATGG + Intronic
1031816380 7:126442478-126442500 TGATAAAAATGACTGTTAAAAGG + Intronic
1033512586 7:142074386-142074408 TTATAGGTATCACTGGCGAATGG - Intronic
1033675326 7:143535561-143535583 TGATAAAGCTCACGGGTAAATGG + Intergenic
1033696511 7:143793877-143793899 TGATAAAGCTCACGGGTAAATGG - Intergenic
1034095328 7:148402543-148402565 TCAGAAATATCAATAGTGAATGG + Intronic
1034502693 7:151461122-151461144 TGACAACGATCCCTGGTGAAGGG + Intergenic
1036374632 8:8189948-8189970 CTATAAAGATTACTGGTGAAGGG + Intergenic
1036854910 8:12233199-12233221 CTATAAAGATTACTGGTGAAGGG - Intergenic
1037712014 8:21362360-21362382 TGATCAGGATCACAGGTGAAGGG + Intergenic
1037964214 8:23120686-23120708 TGACAAATGCCACTGGTGACAGG - Intergenic
1040908161 8:52490302-52490324 AAATAAAGATCACTAGTGAAGGG + Intergenic
1041212552 8:55567370-55567392 TAAAAAAAATCAGTGGTGAAAGG + Intergenic
1041944101 8:63422789-63422811 TTAGAAATATGACTGCTGAAAGG - Intergenic
1043885002 8:85588669-85588691 TGAAATATATTACTGGTGGAAGG - Intergenic
1044500562 8:92950284-92950306 TGATAAAAATCCCTGGGGGAGGG - Intronic
1047261728 8:123268456-123268478 TCATAAATAACACTTTTGAAGGG + Intronic
1047481608 8:125288505-125288527 TGAGAAATATCCCTGGTAAAAGG - Intronic
1049901502 9:171077-171099 TGATAAATCTGACTGATGATAGG - Intronic
1053744535 9:41181372-41181394 TGATAAATCTGACTGATGATAGG - Intronic
1054349803 9:64011265-64011287 TGATAAATCTGACTGATGATAGG - Intergenic
1054482735 9:65683838-65683860 TGATAAATCTGACTGATGATAGG + Intronic
1054683810 9:68249878-68249900 TGATAAATCTGACTGATGATAGG + Intronic
1058568224 9:106310188-106310210 TGATGAATAGCACAGATGAATGG - Intergenic
1059782645 9:117546012-117546034 TGCTAAATATCACTTGGTAAAGG + Intergenic
1061137283 9:128742165-128742187 TGATAAATATCACTGGTGAAAGG - Intronic
1061852294 9:133423385-133423407 TGTTAAATATCACAAGGGAACGG + Intronic
1203457675 Un_GL000220v1:6137-6159 TTATAAATTTCACTTGTGATCGG - Intergenic
1186855534 X:13622584-13622606 AGATAAATACCACTGGGAAAGGG - Intronic
1187466577 X:19532800-19532822 AAATAAATATCAGTGGTGTAAGG - Intergenic
1190555981 X:51636322-51636344 TGATGAATAGAAGTGGTGAAAGG + Intergenic
1192476346 X:71446750-71446772 TAATAAATCTCACTGGTCAAGGG - Intronic
1192961931 X:76140272-76140294 TGATATGTATTTCTGGTGAAAGG - Intergenic
1197343833 X:125307661-125307683 TGCAAAATAACACTGATGAATGG + Intergenic
1198484283 X:137071021-137071043 TGATAAAACTCACTGGTCAAAGG - Intergenic
1199316913 X:146390375-146390397 TGTTGAATAACAGTGGTGAAAGG + Intergenic
1202600637 Y:26590143-26590165 TGATAAAGAGCACTGGGCAAGGG - Intergenic