ID: 1061141345

View in Genome Browser
Species Human (GRCh38)
Location 9:128769074-128769096
Sequence CCGCTGCTGTCAGAAAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061141334_1061141345 30 Left 1061141334 9:128769021-128769043 CCTCCCAAAGCGCTGGCAGTGCT 0: 1
1: 1
2: 14
3: 451
4: 16535
Right 1061141345 9:128769074-128769096 CCGCTGCTGTCAGAAAAGCCAGG No data
1061141338_1061141345 26 Left 1061141338 9:128769025-128769047 CCAAAGCGCTGGCAGTGCTGGGC 0: 1
1: 0
2: 5
3: 27
4: 241
Right 1061141345 9:128769074-128769096 CCGCTGCTGTCAGAAAAGCCAGG No data
1061141336_1061141345 27 Left 1061141336 9:128769024-128769046 CCCAAAGCGCTGGCAGTGCTGGG 0: 1
1: 1
2: 7
3: 30
4: 805
Right 1061141345 9:128769074-128769096 CCGCTGCTGTCAGAAAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061141345 Original CRISPR CCGCTGCTGTCAGAAAAGCC AGG Intronic
No off target data available for this crispr