ID: 1061141946

View in Genome Browser
Species Human (GRCh38)
Location 9:128772386-128772408
Sequence CTTCCAAATGGGAAATTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 236}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061141932_1061141946 29 Left 1061141932 9:128772334-128772356 CCAAAAGGTGCTCCTAACCTCCA 0: 1
1: 0
2: 0
3: 9
4: 311
Right 1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG 0: 1
1: 0
2: 0
3: 30
4: 236
1061141936_1061141946 12 Left 1061141936 9:128772351-128772373 CCTCCATCTAGGGCATGCGCCAC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG 0: 1
1: 0
2: 0
3: 30
4: 236
1061141939_1061141946 -7 Left 1061141939 9:128772370-128772392 CCACCAGGCAACCGAGCTTCCAA 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG 0: 1
1: 0
2: 0
3: 30
4: 236
1061141940_1061141946 -10 Left 1061141940 9:128772373-128772395 CCAGGCAACCGAGCTTCCAAATG 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG 0: 1
1: 0
2: 0
3: 30
4: 236
1061141931_1061141946 30 Left 1061141931 9:128772333-128772355 CCCAAAAGGTGCTCCTAACCTCC 0: 1
1: 0
2: 0
3: 12
4: 88
Right 1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG 0: 1
1: 0
2: 0
3: 30
4: 236
1061141937_1061141946 9 Left 1061141937 9:128772354-128772376 CCATCTAGGGCATGCGCCACCAG 0: 1
1: 0
2: 0
3: 6
4: 96
Right 1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG 0: 1
1: 0
2: 0
3: 30
4: 236
1061141935_1061141946 17 Left 1061141935 9:128772346-128772368 CCTAACCTCCATCTAGGGCATGC 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG 0: 1
1: 0
2: 0
3: 30
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061141946 Original CRISPR CTTCCAAATGGGAAATTGGG CGG Intronic
900807834 1:4779444-4779466 CTTTCACATGGGAAAGTGGCAGG + Intronic
903817805 1:26077778-26077800 CTTCCACATGTGAATTTTGGGGG - Intergenic
904314242 1:29650033-29650055 CTTCCAAATGGCCAGATGGGTGG - Intergenic
905209562 1:36364406-36364428 CTTATAAATGGCTAATTGGGTGG + Intronic
905488785 1:38327454-38327476 TTTCCACATGGAAAATGGGGGGG - Intergenic
905625787 1:39490225-39490247 CTTCCAAATGTGATTTTTGGGGG + Intergenic
905920925 1:41718105-41718127 TCTCCATATGGGAAATTGGCAGG + Intronic
906266068 1:44430991-44431013 CTTCCAAATGGTCAAGTGGATGG + Intronic
908648575 1:66307063-66307085 CTTCTAAATGTGAAATTCAGTGG - Intronic
908934824 1:69362656-69362678 CTGTCGAATGGGAAAGTGGGAGG - Intergenic
910841337 1:91565008-91565030 TTGCCAAATTGGAAATTGAGAGG + Intergenic
912801294 1:112721212-112721234 CATCCAAAAGGGAAACTGGTTGG - Intronic
912929328 1:113942350-113942372 CTTCAAAATGGGAAAATGGCTGG - Intronic
913098859 1:115545066-115545088 TTTCAAAATGTGAATTTGGGGGG - Intergenic
913112589 1:115669949-115669971 CTTCCACATATGAATTTGGGGGG - Intronic
915087778 1:153399737-153399759 CTTCCACCTGGGGAGTTGGGGGG + Intergenic
917642096 1:176992858-176992880 CTTCAACATAGGAATTTGGGTGG - Intronic
917968286 1:180192130-180192152 CTTCAACATAGGAATTTGGGGGG + Intronic
921812145 1:219527323-219527345 CTTCCAAATGGGAAAAAAGGGGG - Intergenic
922786923 1:228287448-228287470 CTTCCAACTGTGAATTTGGCGGG + Intronic
924380308 1:243457025-243457047 CTTCCAAAAAGGAAAATGGGCGG + Intronic
1063087458 10:2832570-2832592 CTTCCACATAGGAATTTGCGGGG - Intergenic
1063624473 10:7676325-7676347 CTTCAACATAGGAATTTGGGGGG - Intergenic
1063758871 10:9048481-9048503 CTACCAAAAGGGAAATGTGGAGG - Intergenic
1065615438 10:27516656-27516678 ATTCCAAATTAGAAGTTGGGAGG - Intronic
1065779965 10:29158091-29158113 CTTGCAAATGGAAAATGGGATGG + Intergenic
1067278056 10:44851868-44851890 CTTCAACATAGGAATTTGGGGGG + Intergenic
1069229522 10:65991709-65991731 CATCCAAATTGGAAAATGGGAGG - Intronic
1072210665 10:93243945-93243967 CTTCAAGGTGGGAAACTGGGAGG - Intergenic
1073759744 10:106616601-106616623 CTTGCTAATGGGACATTGGTAGG + Intronic
1073928702 10:108547936-108547958 CTTCCAAGGGGGAACTTGAGAGG + Intergenic
1074711091 10:116178169-116178191 TTCCCAACTGGGAAACTGGGAGG + Intronic
1074924010 10:118047734-118047756 CTTCCAATTGAGAAATAGAGGGG - Intergenic
1075837114 10:125463363-125463385 CTTCCAAATGGCAACATGGTTGG + Intergenic
1076342928 10:129761987-129762009 GTTTCTAATGGGAACTTGGGAGG - Intronic
1076579218 10:131495648-131495670 CTTCGATATGTGAATTTGGGGGG + Intergenic
1077246975 11:1544459-1544481 CTGCAAAATGGGAATTGGGGAGG - Intergenic
1079501372 11:21105045-21105067 CTTCCACATATGAATTTGGGGGG + Intronic
1080004392 11:27391260-27391282 ATTTCCAATGGGAAAATGGGGGG + Intronic
1080571710 11:33563050-33563072 CTTCAAAATAGGAATCTGGGGGG + Intronic
1080878914 11:36301229-36301251 CTTCCAAATTGGAACTTGGTAGG + Intronic
1081628015 11:44666927-44666949 CTTCCATATGGTAAAATGTGAGG - Intergenic
1081953448 11:47067412-47067434 CTTCAACATGGGAATTTGGGGGG - Intronic
1082008899 11:47437475-47437497 CTTCAACATGGGAATCTGGGGGG + Intergenic
1083321751 11:61851987-61852009 CTGCCAAATGGGATATGGGTAGG + Intronic
1084031280 11:66482085-66482107 CTTCCACATGGGCTTTTGGGAGG + Intronic
1084157568 11:67322723-67322745 CACAGAAATGGGAAATTGGGAGG + Intronic
1086360022 11:86048958-86048980 CTTCCAATTCTGAAAATGGGAGG + Intronic
1086975361 11:93126041-93126063 CTTCCACATATGAATTTGGGAGG + Intergenic
1087353539 11:97063987-97064009 CTTCCAAATTGAATCTTGGGAGG - Intergenic
1087700383 11:101430627-101430649 CTTCCAAAGGAGAAATTAAGGGG - Intergenic
1090004869 11:122992721-122992743 CCTCCAAAAGGTGAATTGGGTGG - Intergenic
1091034126 11:132217895-132217917 CTTACAAATAGGAAAATAGGTGG - Intronic
1094399635 12:30048004-30048026 CTTGCAAATGGCATATTGTGGGG + Intergenic
1095384105 12:41630083-41630105 CTTCCACATATGAATTTGGGAGG - Intergenic
1097114803 12:56689277-56689299 CATTAAAAAGGGAAATTGGGCGG + Intergenic
1097610240 12:61810795-61810817 CTTCCAACTGCCAAAATGGGAGG - Intronic
1103336207 12:120191954-120191976 CTTCCACTGGGGAAATGGGGAGG - Intronic
1106414813 13:29537615-29537637 GTTCCTAATGGGAAATGGTGAGG + Intronic
1106688643 13:32089887-32089909 TTTCCAAATGGCAAATCTGGTGG - Intronic
1107298883 13:38944955-38944977 CTTTCAAATAGAAAATTTGGTGG - Intergenic
1107442976 13:40445088-40445110 CTCCCATATGGGAAATCGAGTGG + Intergenic
1108014592 13:46061389-46061411 CTTCAACATAGGAATTTGGGAGG - Intronic
1108247046 13:48527583-48527605 GTTCCAAATGGGACACTCGGTGG + Intronic
1108714146 13:53062050-53062072 CTTCCCAAGGGGAAAATGGGTGG + Intergenic
1108823376 13:54380935-54380957 CATGCAAATGGGAATTTGGGGGG + Intergenic
1110344879 13:74434480-74434502 CTACAAAATGTAAAATTGGGAGG - Intergenic
1110727322 13:78840159-78840181 CTTCAACATAGGAATTTGGGGGG + Intergenic
1114204337 14:20554612-20554634 CTTGCAGATGGCAAATTGTGGGG - Intergenic
1114688665 14:24559545-24559567 CTTCAAAATGAGAGAATGGGTGG + Intergenic
1115535833 14:34372581-34372603 CTTACAAATGGGGAAGAGGGTGG + Intronic
1116006522 14:39297462-39297484 CTCCCAAATGGGAAATGTGGAGG - Intronic
1116277026 14:42848408-42848430 ATTCCAAAAGGGAAAGTGAGAGG + Intergenic
1117537508 14:56715614-56715636 CTTCCAAATGTGACACTGTGTGG - Intronic
1118135809 14:63025403-63025425 CTTCCAAATAGGAAATAAAGAGG + Intronic
1118256945 14:64213660-64213682 CTTAAAAATGAGAAATTGTGGGG - Intronic
1122281594 14:100626086-100626108 CTTCAAAATATGAACTTGGGGGG + Intergenic
1123770446 15:23523096-23523118 CTTACATATGGCAAATAGGGTGG + Intergenic
1124028241 15:25986739-25986761 CTGCCAAATGAGGAAATGGGAGG + Intergenic
1127962566 15:63900623-63900645 CTTCCACATGTGAATTTGGTGGG - Intergenic
1130788395 15:87124966-87124988 CTTACAAAAGAAAAATTGGGGGG - Intergenic
1131115130 15:89790762-89790784 CTTCCAAATGGGAAAAGGGACGG + Intronic
1131484363 15:92808213-92808235 CTTCTAAATGGGAAATTCTGAGG - Intronic
1131998275 15:98154481-98154503 CTGCCAAACGAGAAAATGGGAGG - Intergenic
1132199977 15:99944628-99944650 ATCCCAACTGGGAAATGGGGTGG + Intergenic
1132736625 16:1389210-1389232 CTTCCACGTAGGAATTTGGGGGG - Intronic
1134087080 16:11364805-11364827 CTTCCAGATGGTAAACTGGAAGG + Intronic
1135062986 16:19286533-19286555 CCTCCATATGGGACACTGGGAGG - Intronic
1138088191 16:54153102-54153124 CTTCCATATAGGAATGTGGGAGG - Intergenic
1138088442 16:54154926-54154948 CTTCAATATAGGAATTTGGGAGG - Intergenic
1138247021 16:55475267-55475289 CTTCCCAATGGGAAACTAAGGGG + Intronic
1139340600 16:66265557-66265579 CTTCCAAATGGGGAGCTGAGGGG + Intergenic
1140077111 16:71710246-71710268 TTTCCAAATGGCAAGGTGGGAGG + Intronic
1140288121 16:73623717-73623739 CTTCCAAAATGAAAATGGGGAGG + Intergenic
1140588043 16:76317923-76317945 CTGTCAAATGGGAAACTGGGGGG + Intronic
1141637615 16:85323044-85323066 CTTCCAAATGCTATTTTGGGAGG - Intergenic
1142250239 16:88988659-88988681 CTTCCACATGGGAATCTGTGGGG + Intergenic
1144494816 17:15739442-15739464 CTTCAACATGGGAACTAGGGAGG + Intronic
1144905436 17:18637230-18637252 CTTCAACATGGGAACTCGGGAGG - Intronic
1144994838 17:19260370-19260392 CTTCCAAATGTGAAGCTGGAGGG + Intronic
1146365982 17:32228194-32228216 CTTTCAAATGGGCAATTCTGAGG + Intronic
1147149588 17:38506777-38506799 CTTCCACATGTGAGTTTGGGAGG + Intronic
1148208329 17:45793413-45793435 CCTCCAAATGGGGACTGGGGAGG + Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1151737292 17:75951725-75951747 TTTACAAATGGGAAACTGAGAGG + Intronic
1153912178 18:9713995-9714017 CTTCAAAATGGGAATTTTGTTGG + Intronic
1153933041 18:9895775-9895797 CTCCCAAATGGGAGATATGGGGG + Intergenic
1154386108 18:13893164-13893186 CAACCAAATAAGAAATTGGGTGG - Intronic
1154485513 18:14868631-14868653 CTTCCACAGGGGAAACTAGGTGG - Intergenic
1155656129 18:28195103-28195125 CTTCAACATGGGAATTTTGGAGG + Intergenic
1157638184 18:49183755-49183777 CTTCAACATAGGAAATTTGGGGG - Intronic
1158315875 18:56210752-56210774 TTTCCACATGGGAATTTGGCTGG + Intergenic
1158646573 18:59253949-59253971 CCCCCAAATGGGAAACTGGCAGG + Intergenic
1159808001 18:72978740-72978762 CTTCCACATATGAATTTGGGCGG + Intergenic
1160714848 19:571611-571633 GATCCAAATGGGATATTTGGGGG + Intronic
1161938483 19:7386919-7386941 CTTCCAGCTGGGGATTTGGGCGG + Intronic
1163049615 19:14672423-14672445 CTTCCTTATGTGAAATAGGGTGG + Intronic
1165976774 19:39682931-39682953 CCTCCAATATGGAAATTGGGAGG - Intergenic
1166382925 19:42364331-42364353 CTTCCACATGTGACAGTGGGAGG - Intronic
925781016 2:7381997-7382019 CTTCCACATAGGAATTTTGGGGG + Intergenic
925979660 2:9166602-9166624 CTTTCAAATGAGAAAATGTGGGG + Intergenic
927208832 2:20626517-20626539 CTTCCTCATGGGACATTTGGAGG - Intronic
927401085 2:22711166-22711188 CATCCAAATAGGAAATTAGGAGG - Intergenic
927449893 2:23199554-23199576 CTTGAAAATGCAAAATTGGGGGG - Intergenic
927648326 2:24894678-24894700 CTTCCAAATGGTAAATTATATGG - Intronic
929354142 2:40999070-40999092 GTTCCGAAGGGGAAATTGAGCGG + Intergenic
932776949 2:74534060-74534082 CTTCCAGATGGGTGAGTGGGGGG - Intronic
933843923 2:86309838-86309860 CTTCAAAATACGAATTTGGGGGG + Intronic
934972573 2:98774957-98774979 CTTCAACATAGGAATTTGGGGGG + Intergenic
934989284 2:98910175-98910197 CTTCTCAATGGGGAAGTGGGAGG - Intronic
935944074 2:108270224-108270246 CTTCCAGATGGGAAGGTGGGTGG - Intergenic
937654041 2:124354518-124354540 TTGCCAGATGGGAAATTGGCTGG + Intronic
938080094 2:128365286-128365308 CTTCCACATGGGATATTGAGTGG + Intergenic
939817891 2:146919071-146919093 CTTATAAATGGTAAATTGTGTGG - Intergenic
945291187 2:208129142-208129164 CTTGCAAATGGGAAGCTGGTTGG - Intronic
945974938 2:216263104-216263126 CATCCAGAAGGGAAAATGGGTGG + Intronic
946177402 2:217929911-217929933 CTGCCAAATGGAGAATGGGGTGG - Intronic
946957070 2:224942190-224942212 CTTCCAAAATGGAAATGGGAGGG - Intronic
946982805 2:225236335-225236357 CTTCCATTTGCAAAATTGGGTGG - Intergenic
948458351 2:238117633-238117655 CTTACAAATGGGGAAATGAGAGG - Intronic
948758369 2:240172759-240172781 CTGCCAAATGGGAAGTTCAGGGG + Intergenic
948869369 2:240790553-240790575 CTTCAAAATATGAAATTAGGGGG - Intronic
1170075077 20:12410380-12410402 TTTGGAAATGGGAACTTGGGAGG + Intergenic
1171515629 20:25730708-25730730 TTTCCAAGTGGGAAATTGAAAGG - Intergenic
1173158305 20:40633543-40633565 GTTCCTTATGGGAAGTTGGGAGG - Intergenic
1174328477 20:49798619-49798641 CTTCCCATTAGGAATTTGGGTGG + Intergenic
1176795823 21:13370846-13370868 CTTCCACAGGGGAAACTAGGTGG + Intergenic
1178472619 21:32906940-32906962 CTTCAACATGTGAATTTGGGGGG + Intergenic
1178738301 21:35172299-35172321 CTTCAAAATATGAATTTGGGAGG - Intronic
1179503197 21:41822642-41822664 ATTCAACATGGGAATTTGGGAGG - Intronic
1180289504 22:10784076-10784098 CTTCCACAGGGGAAACTAGGTGG + Intergenic
1180305395 22:11068723-11068745 CTTCCACAGGGGAAACTAGGTGG - Intergenic
1181599117 22:23938542-23938564 CTTTCTTATGGGAAATTGTGTGG + Intergenic
1181764748 22:25083414-25083436 CTTCAATATGTGAATTTGGGGGG + Intronic
1184318507 22:43719305-43719327 CTACCCAATGTGAAACTGGGTGG + Intronic
1184406414 22:44303265-44303287 CTTCAACATGTGAATTTGGGGGG - Intronic
951125989 3:18983656-18983678 CTTAAAATTGGGAAATTTGGGGG - Intergenic
953502193 3:43447937-43447959 CTTCAAAATGTGAATTTGTGGGG - Intronic
954677820 3:52325353-52325375 CTTCCAACTGGAAAATAGAGGGG + Intronic
955789686 3:62575805-62575827 CTTCCGAATGGGAAAGCTGGTGG + Intronic
956410344 3:68972534-68972556 CTTCCAAATGGCCTCTTGGGTGG - Intergenic
956949365 3:74263079-74263101 CTGCAAAATGTGAAATTGGTAGG + Exonic
957225211 3:77434313-77434335 GTTGCAAATGGGAAATTTGGGGG - Intronic
957397486 3:79660970-79660992 CTTCCAAGAGGGAAATTAGAAGG - Intronic
959904244 3:111693004-111693026 CGTGCAAATGGGAAAGAGGGAGG + Intronic
961748521 3:129081571-129081593 CGTCCAAATGGAAATTTGAGGGG + Intergenic
962240733 3:133748717-133748739 CTTCAAAAGTGGAAATGGGGAGG + Intronic
962552443 3:136508793-136508815 CTTGCAAATCGGAAATTTGTAGG - Intronic
963507689 3:146207682-146207704 CTTCAATATGTGAATTTGGGAGG + Intronic
965432863 3:168611197-168611219 CTTCAAAATGTGAATTTTGGAGG + Intergenic
968801832 4:2747934-2747956 CTTCCACTTAGGAAATTGAGAGG - Exonic
968856967 4:3132677-3132699 CTTCCACGTGGGAGATTGGATGG + Exonic
969203368 4:5623097-5623119 CTTCCAAATGTGAGATTGTTGGG - Intronic
969553615 4:7890825-7890847 CTTCCCACCGGGAAAGTGGGAGG - Intronic
969696375 4:8737438-8737460 CTTCCACATGCGAATTTTGGAGG - Intergenic
970977943 4:22062456-22062478 CTTCCAGTTGGGAAATTGATTGG - Intergenic
976323702 4:83747344-83747366 CTGCAATATGGAAAATTGGGAGG - Intergenic
978430079 4:108624363-108624385 TTTACCAATGGGAAATGGGGTGG + Intronic
980661541 4:135865119-135865141 CATGCAAATGTTAAATTGGGAGG + Intergenic
980988428 4:139717822-139717844 CCTCCAAAAGGGGGATTGGGAGG + Exonic
983711281 4:170719929-170719951 CTTCCAAATCAGAAAGTGGGAGG + Intergenic
983786974 4:171744621-171744643 CTTCCAAATCTGGAATTGGAGGG + Intergenic
985227946 4:187782559-187782581 GTTCCAACTGTGAACTTGGGAGG - Intergenic
985362207 4:189187440-189187462 CTCCCAAATAGGATATTGGGAGG + Intergenic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
986280825 5:6320999-6321021 CTTCAAAATATGAATTTGGGAGG + Intergenic
986298759 5:6461902-6461924 TATCCAAATGGGACATTCGGTGG - Intronic
992103188 5:73426978-73427000 CTTGTAAGAGGGAAATTGGGAGG - Intergenic
994323571 5:98422620-98422642 CTACCAAAAGAGATATTGGGAGG + Intergenic
995784899 5:115817059-115817081 CTTCCAAATAGAGAATTGTGAGG + Intergenic
996258373 5:121434660-121434682 CCTCCAGTTGGGAAATTAGGAGG + Intergenic
996954918 5:129171361-129171383 CTTCCATGTGGGAAATAGGCAGG - Intergenic
997376784 5:133403220-133403242 CTTCAAAATGGGCAATTAGTGGG - Intronic
997767863 5:136523368-136523390 CTTTGGAATGGGAAATTTGGGGG + Intergenic
998217994 5:140252063-140252085 CTTACAAATGGGAAAATAGAGGG - Intronic
999182538 5:149680412-149680434 CTGCCAAAAGGGAAATGGGCAGG - Intergenic
999940250 5:156534536-156534558 TTTCCATATGGGAACTAGGGAGG - Intronic
1001929253 5:175661101-175661123 ATTCCAAGTGGGAAGTTTGGAGG - Intronic
1002724297 5:181284067-181284089 CTTCCACAGGGGAAACTAGGTGG - Intergenic
1003038047 6:2662124-2662146 TTTCCAAATGGGGAGTGGGGAGG + Intergenic
1003539075 6:7002379-7002401 CTTCCAGGTAGGAAGTTGGGGGG + Intergenic
1005047313 6:21654413-21654435 CTTCAATATGTGAACTTGGGGGG + Intergenic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1005560447 6:27035052-27035074 CATCCACATGGAAGATTGGGAGG - Intergenic
1006885300 6:37376659-37376681 TTTCAACATGGGAATTTGGGAGG + Intronic
1006987856 6:38188677-38188699 CTTCCAAAGAGGAATTTGGGAGG - Intronic
1007045435 6:38768930-38768952 CTGCCAATTGGCAAATTTGGGGG - Intronic
1008067457 6:47064209-47064231 CTTCCACCTGTGAAATTGTGAGG - Intergenic
1009606241 6:65871820-65871842 TTTCAAAATGGAAAATTGTGGGG - Intergenic
1009744555 6:67796611-67796633 TTTCAAAATAGGAACTTGGGGGG - Intergenic
1010750832 6:79614649-79614671 CTTCAACATAGGAATTTGGGAGG - Intergenic
1011295477 6:85822460-85822482 CACCCAAATTGGAAATTAGGAGG - Intergenic
1012226654 6:96711484-96711506 CTTGCAAATGGAAATTAGGGAGG - Intergenic
1014906081 6:127029751-127029773 ATTCTGAATGGGAAAATGGGTGG - Intergenic
1017205479 6:151800433-151800455 CTTCAATATGTGAATTTGGGTGG - Intronic
1018722621 6:166584391-166584413 CTTCCAAATGTGAACATGGAGGG + Intronic
1019504757 7:1385329-1385351 CTTGCAGATGGGAGGTTGGGTGG + Intergenic
1022137794 7:27465838-27465860 CTTCCAAATGGAGACATGGGGGG - Intergenic
1031492606 7:122407500-122407522 CTTTCATATGTGAAATGGGGAGG - Intronic
1031733466 7:125327146-125327168 CTTCTTAATGGGAAAATGAGTGG - Intergenic
1032087586 7:128891893-128891915 CTTCCAAGTGGGCACTTGTGTGG - Intronic
1032179804 7:129665164-129665186 CTTGCAGATGGGAAATGGGAAGG + Intronic
1032327211 7:130941034-130941056 CTTCCAAATGGAAATCAGGGCGG + Intergenic
1035357374 7:158284586-158284608 CTTCCTAATGAGAATTTAGGAGG + Intronic
1035600968 8:896515-896537 CTTCAACATAGGAATTTGGGGGG - Intergenic
1038845491 8:31225797-31225819 CTTCCATCTTGGAAATTGGTGGG - Intergenic
1038989687 8:32854485-32854507 CATCCAAATGGCAAATATGGAGG - Intergenic
1039408769 8:37334625-37334647 GTTACAAATGGCAAATTGGGAGG - Intergenic
1040333898 8:46406408-46406430 CTTCCAGAAGTGAAAATGGGGGG + Intergenic
1040946595 8:52891690-52891712 CTTCAACATAGGAATTTGGGGGG - Intergenic
1041344470 8:56882350-56882372 CTTCAAAATGGAAAAGTTGGGGG + Intergenic
1041382338 8:57263096-57263118 CTTTCAAATGGACAATTTGGTGG + Intergenic
1042455850 8:69001647-69001669 CTTCCATATAGGAATTTGGGGGG + Intergenic
1044339140 8:91026799-91026821 CTTACCAATGGGAAATGGGATGG + Intronic
1044448356 8:92304396-92304418 CCAGCAAATGGGAAATTGGAGGG + Intergenic
1044517585 8:93157054-93157076 GTTCCAAATAGGAAATGGGGTGG + Intronic
1045739076 8:105333063-105333085 TTTCCAAATTGGAATTTGGTAGG - Intronic
1045750795 8:105481604-105481626 CTTCCACATAGGAATTTCGGAGG + Intronic
1046311898 8:112448344-112448366 CTTCCACATATGAAACTGGGTGG + Intronic
1047126282 8:121964819-121964841 CTACCAAAAGGTAAATTGTGTGG + Intergenic
1048177095 8:132162696-132162718 CTTCCAAGTGGGATTTTGTGTGG + Intronic
1048898980 8:139020145-139020167 CTATGAAATGGGACATTGGGAGG - Intergenic
1049359521 8:142205684-142205706 TTTCCAGATGGGAATATGGGAGG - Intergenic
1052333937 9:27300646-27300668 CTTCAACATGTGAAATTTGGGGG - Intergenic
1054935533 9:70683768-70683790 CTTCCAAGTGGAAACTTTGGGGG - Intronic
1055196724 9:73603256-73603278 CTTGCCAATGGGAATGTGGGAGG + Intergenic
1055691689 9:78838750-78838772 CTTCCAGAGGGGATATAGGGTGG + Intergenic
1057667859 9:97060822-97060844 GCTCCAAATGGGGAATTTGGTGG - Intergenic
1059838805 9:118189158-118189180 CTTCGTAATGGTAAAATGGGGGG + Intergenic
1060492030 9:124092160-124092182 CTTCCACATACGAATTTGGGGGG - Intergenic
1060927275 9:127463694-127463716 TTTCCACATAGGAACTTGGGAGG + Intronic
1061141946 9:128772386-128772408 CTTCCAAATGGGAAATTGGGCGG + Intronic
1061432170 9:130537877-130537899 AGGCCAAAAGGGAAATTGGGAGG - Intergenic
1062603493 9:137331444-137331466 CATCCAAATGGGAAAACAGGAGG + Intronic
1062617457 9:137404219-137404241 CTTCAACATGGGAATTTGGGGGG + Intronic
1187212844 X:17246914-17246936 CTTCCTAAAGGGAACTTGGGAGG + Intergenic
1187684733 X:21804956-21804978 CTTTCTAATGGGAAATGGTGGGG - Intergenic
1187940024 X:24372309-24372331 CTTTCCCATTGGAAATTGGGAGG - Intergenic
1192809502 X:74536441-74536463 CTCCCAAATGGGGAAATGGATGG - Intergenic
1195025606 X:100874124-100874146 CTTGACAATGGGAAACTGGGTGG - Exonic
1195301030 X:103530179-103530201 CTTCCAAATGGGAAGCTGCTGGG - Intergenic
1197427437 X:126314761-126314783 TATCCAAATTGGAAATTGGGAGG + Intergenic
1197891254 X:131272899-131272921 ATTCCAAATGGGGAAATGGTGGG - Intergenic
1198868605 X:141152410-141152432 CTTCAACATAGGAAATTGGGGGG + Intergenic
1199858497 X:151779318-151779340 CTTCAACATAGGAATTTGGGCGG + Intergenic
1201622007 Y:15969906-15969928 ACTCCAAATGGGAAAGTGGGAGG + Intergenic