ID: 1061144153

View in Genome Browser
Species Human (GRCh38)
Location 9:128787398-128787420
Sequence TGGCCAGGAGTGGCCCAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 513
Summary {0: 1, 1: 1, 2: 4, 3: 61, 4: 446}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061144153_1061144172 25 Left 1061144153 9:128787398-128787420 CCCGGCTGGGCCACTCCTGGCCA 0: 1
1: 1
2: 4
3: 61
4: 446
Right 1061144172 9:128787446-128787468 GGGGAAGCGCGGGTGTGGCCAGG 0: 1
1: 0
2: 2
3: 24
4: 296
1061144153_1061144171 20 Left 1061144153 9:128787398-128787420 CCCGGCTGGGCCACTCCTGGCCA 0: 1
1: 1
2: 4
3: 61
4: 446
Right 1061144171 9:128787441-128787463 AGAAGGGGGAAGCGCGGGTGTGG 0: 1
1: 0
2: 3
3: 25
4: 412
1061144153_1061144167 14 Left 1061144153 9:128787398-128787420 CCCGGCTGGGCCACTCCTGGCCA 0: 1
1: 1
2: 4
3: 61
4: 446
Right 1061144167 9:128787435-128787457 CCCCTCAGAAGGGGGAAGCGCGG 0: 1
1: 0
2: 2
3: 16
4: 172
1061144153_1061144164 6 Left 1061144153 9:128787398-128787420 CCCGGCTGGGCCACTCCTGGCCA 0: 1
1: 1
2: 4
3: 61
4: 446
Right 1061144164 9:128787427-128787449 CCCTTCTGCCCCTCAGAAGGGGG 0: 1
1: 0
2: 1
3: 24
4: 220
1061144153_1061144169 15 Left 1061144153 9:128787398-128787420 CCCGGCTGGGCCACTCCTGGCCA 0: 1
1: 1
2: 4
3: 61
4: 446
Right 1061144169 9:128787436-128787458 CCCTCAGAAGGGGGAAGCGCGGG 0: 1
1: 0
2: 2
3: 11
4: 193
1061144153_1061144159 3 Left 1061144153 9:128787398-128787420 CCCGGCTGGGCCACTCCTGGCCA 0: 1
1: 1
2: 4
3: 61
4: 446
Right 1061144159 9:128787424-128787446 TGCCCCTTCTGCCCCTCAGAAGG 0: 1
1: 0
2: 0
3: 21
4: 261
1061144153_1061144160 4 Left 1061144153 9:128787398-128787420 CCCGGCTGGGCCACTCCTGGCCA 0: 1
1: 1
2: 4
3: 61
4: 446
Right 1061144160 9:128787425-128787447 GCCCCTTCTGCCCCTCAGAAGGG 0: 1
1: 0
2: 0
3: 18
4: 178
1061144153_1061144162 5 Left 1061144153 9:128787398-128787420 CCCGGCTGGGCCACTCCTGGCCA 0: 1
1: 1
2: 4
3: 61
4: 446
Right 1061144162 9:128787426-128787448 CCCCTTCTGCCCCTCAGAAGGGG 0: 1
1: 0
2: 2
3: 26
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061144153 Original CRISPR TGGCCAGGAGTGGCCCAGCC GGG (reversed) Intronic
900431043 1:2603375-2603397 TGGAGAGGAGCAGCCCAGCCTGG - Intronic
900437236 1:2636832-2636854 CAGCCAGGTGTGGCCCAGGCAGG - Intronic
900620980 1:3587873-3587895 TGGCCAGGAGTGGCCAGGAGGGG + Intronic
900621062 1:3588073-3588095 TGGCCAGGAGTGGCCAGGAGGGG + Intronic
900621250 1:3588523-3588545 TGGCCAGGAGTGGCCAGGAGGGG + Intronic
901119029 1:6875202-6875224 TTCCTAGGAGTGGCTCAGCCAGG - Intronic
901374879 1:8830799-8830821 AGGTCAGGAGTTGACCAGCCTGG + Intergenic
901628635 1:10637671-10637693 TGGCCAGGTGTGTGCCTGCCAGG + Exonic
901643829 1:10706241-10706263 TGGGCAGGAGGGCCCCAGCCTGG - Intronic
901778190 1:11575120-11575142 AGGCCAGGAGTTCACCAGCCTGG - Intergenic
901845653 1:11980508-11980530 TGGCGGGGACTGGCCCGGCCCGG + Intronic
901964243 1:12853032-12853054 AAGCCAGGAGTTGACCAGCCTGG + Intronic
902450189 1:16491724-16491746 TGGGCATGAGCGGTCCAGCCTGG + Intergenic
902450543 1:16494195-16494217 TGGGCATGAGCGGTCCAGCCTGG - Intergenic
902502650 1:16921409-16921431 TGGGCATGAGCGGTCCAGCCTGG - Intronic
902535513 1:17117628-17117650 TGGCAAAGAGAGGCCCAGCTGGG - Intronic
902825377 1:18969893-18969915 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
902881060 1:19372000-19372022 TCTCCAGGAGTGGAGCAGCCAGG - Intronic
902940919 1:19799789-19799811 CGGCGGGGAGTGGCCCAGCGAGG + Intronic
903363951 1:22794464-22794486 TGGGCAGGAACGGCCCATCCGGG - Intronic
904383244 1:30125396-30125418 TGGGCAGGGGCTGCCCAGCCAGG - Intergenic
904499807 1:30907584-30907606 TAGCCAACAGTGGCCCAGCCAGG + Intronic
904673092 1:32180432-32180454 AGCCCAGGAGCGGCCCAGCCAGG + Exonic
905035469 1:34915436-34915458 TGGGCAGGAGTTACTCAGCCTGG + Intronic
905201873 1:36321441-36321463 CGGGCAGGAGGGGCCCAGGCGGG + Intronic
905329178 1:37180139-37180161 TGTCCATGAGTTGCGCAGCCCGG + Intergenic
906199552 1:43950407-43950429 TGGTCAGGAGGGGAACAGCCAGG - Intronic
906325591 1:44843402-44843424 AGGCGCGGGGTGGCCCAGCCTGG - Intergenic
907440320 1:54474808-54474830 CGGCCGGGGGTGGCCCAGCTGGG + Intergenic
907587427 1:55633662-55633684 TTTCCAGGATTGCCCCAGCCTGG + Intergenic
908292101 1:62677916-62677938 AGGCCAGGAGTTCTCCAGCCTGG + Intronic
909334902 1:74461188-74461210 TAGTCAAGAGTGGCCCAGCATGG + Intronic
910819434 1:91329872-91329894 TGGCCACCAGTTGGCCAGCCAGG - Intronic
911090280 1:94012113-94012135 TGGACAGCAGTGGCCCAGCCAGG - Intronic
913957141 1:143317175-143317197 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
914051455 1:144142539-144142561 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
914127742 1:144824002-144824024 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
915512242 1:156392694-156392716 GGGCCAGGAGTGCCCCAGCTGGG + Intergenic
915954322 1:160209923-160209945 GGCCCAGCAGTGGCCCTGCCAGG - Intronic
917133308 1:171763914-171763936 TGCCGAGGAGTGGCCCCGGCTGG + Intergenic
920186158 1:204160705-204160727 TGTCCAAGAGTGGCCCAGACAGG + Intronic
921009176 1:211124004-211124026 TGTCCCGGAGTGTTCCAGCCAGG + Intronic
921111835 1:212045986-212046008 AGGCCAGGAGTTAACCAGCCTGG - Intronic
921925396 1:220706633-220706655 TGGCCAGGAGAGGCCACTCCCGG + Intergenic
922616289 1:226963058-226963080 TGCCCAGGAGTGGGACAGCCTGG + Intronic
922765111 1:228152484-228152506 TGGTCAGAGCTGGCCCAGCCAGG + Intronic
923391157 1:233515369-233515391 TGGCCCTGGGTGGCCCCGCCAGG - Intergenic
1062898395 10:1122484-1122506 TGGGCATGAGTGGCCCACCCAGG - Intronic
1063094522 10:2898143-2898165 TGGCACCGAGTGGCCCAGTCAGG - Intergenic
1065029667 10:21572821-21572843 AGGTCAGGAGTTGACCAGCCTGG - Intronic
1065596673 10:27319879-27319901 GGGCGAGGGGAGGCCCAGCCCGG + Intergenic
1066088102 10:31990859-31990881 AGGCCAGGAGTTGCTCAGCCTGG + Intergenic
1067837959 10:49653175-49653197 TAGCCAGAAGTGGTCCGGCCAGG + Intronic
1069870448 10:71529744-71529766 TGGCCGGGAGCCACCCAGCCAGG - Intronic
1071562462 10:86654972-86654994 TGGCCAGGAGGGGACCAGGAAGG - Intronic
1073120920 10:101122175-101122197 TGGCCAACAGAGCCCCAGCCAGG - Intronic
1073604735 10:104882758-104882780 TGGCCAGGAGTGGCACTGGGTGG - Intronic
1075047570 10:119158406-119158428 AGGCCAGGAGTTGACCAGCCTGG + Intronic
1075334221 10:121597438-121597460 TGGCCAGGGGTGGCACTGCTGGG - Intronic
1075335322 10:121604743-121604765 TGCCCAGGTGTTGCCCAGGCTGG + Intergenic
1075376560 10:121982553-121982575 TGGCCATGTGTAGTCCAGCCAGG + Intergenic
1075732919 10:124646952-124646974 TACCCAGGAATGGCCCGGCCAGG - Intronic
1075762293 10:124865952-124865974 TGGCCAGGAGTTCCCGAACCTGG - Intergenic
1076248526 10:128966472-128966494 TGCCCTGGAGTGCCCAAGCCAGG + Intergenic
1076854049 10:133106566-133106588 TGCCCAGGATGGGCACAGCCTGG + Intronic
1077388250 11:2285856-2285878 CGGCCTGGGATGGCCCAGCCAGG - Intergenic
1077418328 11:2436360-2436382 TGGTCAGTAGTGGCCCACCTTGG + Intergenic
1077488036 11:2848044-2848066 AGGCCAAGAGTGGCCCCACCTGG + Exonic
1077957015 11:7031380-7031402 TGCCCAGAAGTGTCCCACCCTGG - Intronic
1079128112 11:17733058-17733080 CGGCCTGGTGTGGCCCATCCTGG - Intergenic
1079128117 11:17733073-17733095 TGGCCTGGTGTGGCCCGGCCTGG - Intergenic
1081641215 11:44755709-44755731 AGGCTGGCAGTGGCCCAGCCTGG + Intronic
1083313243 11:61796852-61796874 TGGCCACCAGTTGGCCAGCCAGG - Exonic
1083638862 11:64134646-64134668 TGTACAGGTGTGGCGCAGCCGGG - Intronic
1083895636 11:65618481-65618503 CGACCAGGAGCGGCTCAGCCAGG - Exonic
1084181822 11:67450756-67450778 TGGCCTGGCATGGCCAAGCCTGG - Intergenic
1084971543 11:72774821-72774843 TGGCTCCAAGTGGCCCAGCCAGG + Intronic
1085694750 11:78694593-78694615 TAGCCATGAGTCGCCAAGCCAGG - Intronic
1087148983 11:94841243-94841265 TGGCCAGGTGTTGGCCAGGCTGG - Intronic
1088889907 11:114036253-114036275 TGGCCGCGGGTGGCCCAGCAGGG + Intergenic
1089696916 11:120221613-120221635 TGGCCAGCAGAGGCAAAGCCAGG + Intronic
1091367932 11:135037690-135037712 TGGAGAAAAGTGGCCCAGCCGGG - Intergenic
1091752485 12:3031559-3031581 TGGCCCTGAGTCCCCCAGCCAGG + Intronic
1092160426 12:6312564-6312586 TGGGCAGGAGAGGCGGAGCCAGG + Intronic
1092842240 12:12553751-12553773 AGGTCAGGAGTAGACCAGCCTGG - Intronic
1094697842 12:32839260-32839282 TGGCCTGGATTGTCCAAGCCTGG - Intronic
1095575552 12:43734169-43734191 TGGCTAGGAATGGCCTGGCCTGG - Intronic
1096217189 12:49804196-49804218 TGACCAGGAGATACCCAGCCTGG - Intronic
1096553348 12:52388762-52388784 TGGACAGGAATGGCCCAGGAGGG + Intergenic
1098914140 12:76239861-76239883 TTGCCATGTGTGGCCCAGGCTGG - Intergenic
1100311459 12:93398471-93398493 AGGGCAGGAGTGGACCAGCCTGG + Intronic
1101448298 12:104754119-104754141 TGGCCTGGAGTTTCCCAGCTTGG - Intronic
1103700740 12:122847618-122847640 AGGCCAGGTGGGCCCCAGCCGGG + Intronic
1103763959 12:123269144-123269166 CAGCCAGGAGTGGCACAGCTGGG - Intronic
1104399038 12:128460561-128460583 TGGCAATGAGTGGCACCGCCTGG - Intronic
1104592030 12:130092452-130092474 GAGCCAGGGGTGGCCCAGCAGGG + Intergenic
1104665036 12:130641834-130641856 TGGCTTTGAGGGGCCCAGCCCGG - Intronic
1104906179 12:132214627-132214649 TGGCCAGGAATGGGCAAGGCCGG - Intronic
1104984423 12:132588600-132588622 TTGCCAGGAGGAGCCCAGCAGGG - Intergenic
1105883220 13:24621723-24621745 AGGTCAGGAGTTGACCAGCCTGG - Intergenic
1106144473 13:27039360-27039382 TGGGCAGGACAGTCCCAGCCAGG - Intergenic
1106557030 13:30818637-30818659 TCACCAGGAGTGGGCCAGGCTGG - Intergenic
1106719016 13:32419970-32419992 AGGCCAGGTGTGGCCGAACCTGG + Intronic
1107840571 13:44452548-44452570 TCCCCATGAGTAGCCCAGCCAGG - Intronic
1109597512 13:64575983-64576005 AGGTCAGGAGTTGGCCAGCCTGG + Intergenic
1110163426 13:72407508-72407530 TGACCAGGATTGGCCCATCCTGG + Intergenic
1110565869 13:76957118-76957140 TGGCCATGGGTGCCCCAGCATGG - Exonic
1113292181 13:108919245-108919267 GGGGCAGGAAGGGCCCAGCCAGG - Intronic
1113444737 13:110356534-110356556 TGGGCAGGAGTGGGCCACCACGG - Intronic
1113661403 13:112108418-112108440 TGGCCATCAGTGACCCAGGCTGG - Intergenic
1115119871 14:29927171-29927193 TGGCGCGGAGAGGGCCAGCCGGG + Intronic
1115746831 14:36446669-36446691 TTGCCAGAAGTTGCCCAGCCGGG + Intergenic
1117231415 14:53723207-53723229 AGGTCAGGAGTTGACCAGCCTGG - Intergenic
1117605506 14:57424370-57424392 AGGCCAGGAGTTCACCAGCCTGG + Intergenic
1117770197 14:59126514-59126536 AGGTCAGGAGTTGACCAGCCTGG + Intergenic
1119319072 14:73718811-73718833 GGCCCAGGACTGGGCCAGCCTGG + Exonic
1121412221 14:93756114-93756136 AGGCCAGGAGTTGACCAGCCTGG - Intronic
1122071794 14:99209723-99209745 TGCCCTGGAGTGGACCGGCCAGG + Intronic
1122515926 14:102308406-102308428 AGGGCTGGAGTGGCCCAGCTAGG - Intergenic
1122632117 14:103111868-103111890 TGGCCATGAGTGTCCCAGGCAGG + Intergenic
1122694289 14:103545325-103545347 AGGCCTTGGGTGGCCCAGCCTGG + Intergenic
1122813087 14:104298580-104298602 TGGCAAGGTGTGAACCAGCCAGG + Intergenic
1202931215 14_KI270725v1_random:32869-32891 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1123421208 15:20138809-20138831 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1123443921 15:20307978-20308000 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1123472969 15:20568505-20568527 TGGCTTGGAGTGCCCCAGCGAGG + Intergenic
1123530434 15:21145349-21145371 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1123645037 15:22431848-22431870 TGGCTTGGAGTGCCCCAGCGAGG - Intergenic
1123751405 15:23360872-23360894 TGGCTTGGAGTGCCCCAGCGAGG + Intronic
1124248982 15:28095249-28095271 AGGGCAGGAGTGGCCCAGCCAGG + Intronic
1124283775 15:28384790-28384812 TGGCTTGGAGTGCCCCAGCGAGG + Intronic
1124298922 15:28526823-28526845 TGGCTTGGAGTGCCCCAGCGAGG - Intronic
1124416461 15:29476558-29476580 TGTCCAGGTCTGGCCCTGCCTGG - Intronic
1125749491 15:42019093-42019115 TGCCCAGGAGTGGCAGAGCCAGG + Intronic
1125756761 15:42070111-42070133 TGGCCCGGAGAGAACCAGCCCGG + Intronic
1126341171 15:47642624-47642646 AGACCTGGAGTGGCCCAGCCGGG + Intronic
1127774327 15:62253616-62253638 TGCCCAGGAGGGGCCCAGTTAGG - Intergenic
1127889777 15:63239618-63239640 AGGTCAGGAGTTGGCCAGCCTGG - Intronic
1128493958 15:68180307-68180329 AGCCCAGAAGTTGCCCAGCCTGG - Intronic
1128570798 15:68731454-68731476 GAGATAGGAGTGGCCCAGCCTGG + Intergenic
1128681534 15:69655936-69655958 TGGTCAGGAGTTGGCCAGGCTGG + Intergenic
1128698954 15:69789959-69789981 TGCCAGGGAGTGGCCCAGCCAGG + Intergenic
1129065793 15:72902851-72902873 TGGCCAGGAAACGCCAAGCCGGG - Intergenic
1129192720 15:73946874-73946896 TGTCCTGGAGTGACCCAGCTAGG + Intronic
1129608815 15:77037644-77037666 TGGGCAGCAGTGGCCAGGCCAGG + Intergenic
1129724993 15:77897165-77897187 TGGCCAAGGGGGGCACAGCCTGG + Intergenic
1130286010 15:82555228-82555250 AGCCGAGGAGTTGCCCAGCCTGG - Intronic
1130302374 15:82689540-82689562 TGGCCAGGGGAGGCTCAGGCAGG + Intronic
1130378355 15:83350530-83350552 GGGCCAGCACTGGCCCACCCTGG + Intergenic
1130889428 15:88120644-88120666 AGGCCAGGAGTGCCCCAGGTTGG + Intronic
1131187264 15:90285540-90285562 GCGACAGGATTGGCCCAGCCGGG + Intronic
1131248280 15:90814595-90814617 TGGCCAGGAGTGGCAAAGCTGGG - Intronic
1131257163 15:90870596-90870618 TGGCCAGGAGCTTCCCAGGCTGG - Intronic
1131421006 15:92305352-92305374 TGGCCAGGAGGGGCGCAACAAGG - Intergenic
1132203446 15:99970674-99970696 AGGCCAAGAGTTGACCAGCCTGG - Intergenic
1132621203 16:869005-869027 TGGCCAGGAGCTTGCCAGCCAGG + Exonic
1132855136 16:2041377-2041399 TGGCCCAGAGTCACCCAGCCAGG + Intronic
1132989096 16:2783991-2784013 AGGTCAGGAGTGGCTCAGCTAGG + Exonic
1133131670 16:3679888-3679910 TGGCCAGACAGGGCCCAGCCAGG + Intronic
1133171666 16:3985833-3985855 GGGCCAGGGGTGGCCCAGAGGGG - Intronic
1134059901 16:11192923-11192945 TGGGCAGGATTGTCCCAGGCTGG + Intergenic
1136136442 16:28259312-28259334 TGGGCAGGAGTCCCCGAGCCAGG - Intergenic
1136722281 16:32335870-32335892 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1136840598 16:33541849-33541871 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1136911396 16:34147186-34147208 TCGCCGGGCGTAGCCCAGCCAGG - Intergenic
1137678545 16:50317386-50317408 TTGCCAGGAGAGCCCCCGCCGGG - Exonic
1137744509 16:50810745-50810767 TGGCGAGGAGGGGCGCTGCCAGG + Intergenic
1138360759 16:56425460-56425482 CAGCCAGGAGCGGCCCGGCCCGG - Exonic
1138457868 16:57131713-57131735 GGGCCAGGAGGGGCCAGGCCTGG - Intronic
1138551214 16:57749722-57749744 TGGCCAGGAGCGGCCCAGCCTGG - Intronic
1139563447 16:67758135-67758157 TGGCCAGGAACGGCCCAGGGGGG + Intronic
1139566783 16:67782663-67782685 AGGTCAGGAGTTGACCAGCCTGG - Intronic
1139682384 16:68575135-68575157 TGGCCAGCAGTGTCCCCACCTGG + Intronic
1139896126 16:70289294-70289316 TGGCCTGGAGAAGCCCAGTCTGG - Intronic
1139956564 16:70696061-70696083 GGGCTAGGTGTGGCCCTGCCTGG - Intronic
1140104204 16:71944471-71944493 AGGCCAGGAGTTGACCAGCCTGG + Intronic
1141094958 16:81156656-81156678 CGGTCAGGAGTTGACCAGCCTGG - Intergenic
1141394335 16:83691448-83691470 TTGGGAGGAGTGGCCCTGCCTGG + Intronic
1141576180 16:84964716-84964738 TGGGCAGGGCTGGCCCACCCAGG + Intergenic
1141672319 16:85498777-85498799 TGGCCAGGGGTGGCACAGGCAGG + Intergenic
1141732735 16:85833757-85833779 TCACCAGGTCTGGCCCAGCCGGG + Intergenic
1141733001 16:85834816-85834838 TTACCAGGAGTTGACCAGCCAGG + Intergenic
1142005051 16:87685649-87685671 CTGCGTGGAGTGGCCCAGCCAGG - Intronic
1142149733 16:88507365-88507387 TGGCCATCAGTGACCCAGCCAGG + Intronic
1142234640 16:88915857-88915879 TGGCAGGGAGTGGCCCAGAGAGG - Intronic
1142261194 16:89043205-89043227 TGGCCAGGTCTGGGCCGGCCTGG + Intergenic
1142337474 16:89499180-89499202 TTCCCAGAACTGGCCCAGCCAGG - Intronic
1203004150 16_KI270728v1_random:181894-181916 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1203135758 16_KI270728v1_random:1718301-1718323 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1203150763 16_KI270728v1_random:1842146-1842168 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1142599269 17:1045539-1045561 TGCCCAGGAGTGGGCCAGGGCGG - Intronic
1143448295 17:7021513-7021535 TGGCCAGGAATGGCCGACCATGG - Intergenic
1144202573 17:12954511-12954533 TGGCCAGGAGAGGCCGTGCGTGG + Intronic
1144620291 17:16814584-16814606 TGGCCAGGGGTGCCCCAGCTGGG - Intergenic
1144843189 17:18201373-18201395 TGGAGAGGAGTGGCAGAGCCAGG - Intronic
1146283797 17:31560978-31561000 TGGCAAGGGGTGGGCCAACCTGG - Intergenic
1146928579 17:36762112-36762134 TGGCCAGGCCTGGACAAGCCTGG - Intergenic
1146950187 17:36900210-36900232 GGGCCAGGGCTGGCACAGCCTGG + Intergenic
1147035418 17:37676294-37676316 TGGCCAGGGGTGGACCTGCCAGG + Intergenic
1147571677 17:41575462-41575484 TGGCCAGGGGAGCCCCAGCTGGG - Intergenic
1147769329 17:42856786-42856808 AGGCCAGGCATGGCCCAGCCTGG + Exonic
1148035105 17:44654542-44654564 AGCCCAGGAGTTGCCCAGCCAGG - Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1149543295 17:57484734-57484756 AGGCCATGAGTAGCCCAGCAGGG - Intronic
1150005160 17:61464535-61464557 TGTCCCAGAGTGGACCAGCCGGG + Intronic
1150739840 17:67770409-67770431 TGGCCAGGAGCTCACCAGCCTGG - Intergenic
1151318273 17:73337213-73337235 TGGCCAGGCGGAGCCCAGCCTGG + Exonic
1151496513 17:74461261-74461283 TGGCCAGTACCGGCCTAGCCTGG - Intergenic
1152458164 17:80427826-80427848 TCCCCTGGAGCGGCCCAGCCTGG - Intronic
1152513262 17:80804680-80804702 CAGCTAGGAGTGGCCGAGCCTGG + Intronic
1152553684 17:81042541-81042563 TGTCCAGGCGTGCCCCTGCCTGG + Intronic
1152561104 17:81079195-81079217 TGGGGAGCAGGGGCCCAGCCGGG + Intronic
1153736279 18:8071713-8071735 CGGCCAGGAGAGGCCCCGACTGG - Intronic
1154457956 18:14547064-14547086 AGGTCAGGAGTTGACCAGCCTGG - Intergenic
1154494520 18:14945661-14945683 TGTTCAGGAGTGGCTCAACCTGG - Intergenic
1156273165 18:35555958-35555980 AGGTCAGGAGTTGACCAGCCTGG - Intergenic
1156333984 18:36151961-36151983 CGGTCAGGAGTTGACCAGCCTGG - Intronic
1156462558 18:37329541-37329563 TGGCCAGATGTGGCACAGCACGG + Intronic
1157365345 18:47059206-47059228 TGGCCAGGAGTGGCTGAGTTTGG - Intronic
1157581571 18:48776916-48776938 TGGCCTGAGGTCGCCCAGCCAGG - Intronic
1158204796 18:54980716-54980738 AGGTCAGGAGTTGACCAGCCTGG - Intergenic
1158453438 18:57586679-57586701 CGCCCAGCAGTGGCCGAGCCGGG + Intronic
1159020550 18:63139580-63139602 TGCCCAGCAGTGGCCTTGCCAGG + Intronic
1160923682 19:1532810-1532832 TAGCCAGGAGTGGCTGAGCGCGG - Intronic
1161361389 19:3852053-3852075 TGGCCAGGCGGGGCTCAGCTGGG + Intronic
1162019314 19:7861496-7861518 TGGCCTGGTGTGGCCTGGCCTGG + Intronic
1162130729 19:8524720-8524742 TGGCCAGGAGTGGCTTTGCAGGG + Intronic
1162468409 19:10857006-10857028 AGCCCAGGAGTTACCCAGCCTGG - Intronic
1162567073 19:11450518-11450540 AGGCCAGGAGTTGACCAGCCTGG - Intronic
1162629700 19:11917433-11917455 TACCTAGGAGTGGGCCAGCCTGG + Intergenic
1162634754 19:11958664-11958686 TGCCTAGGAGTGGGCCAGCCTGG + Intronic
1163288621 19:16364583-16364605 GGACCAGGAGTGGCCCTGCATGG - Intronic
1163552605 19:17974025-17974047 TGGCCAAGAGTGAGCCAGCCCGG + Exonic
1163677112 19:18660674-18660696 GGGGCAGGAGTCCCCCAGCCTGG - Intronic
1163862202 19:19748363-19748385 TGGCCAGGGATGGCCAGGCCTGG + Intergenic
1164722912 19:30445125-30445147 TGGCCATGAGCTGCCAAGCCTGG - Exonic
1165176821 19:33936415-33936437 TGGACTGGCGTGGCCCTGCCTGG - Intergenic
1165332895 19:35151166-35151188 TGGCTCTGGGTGGCCCAGCCAGG - Intronic
1165739825 19:38198486-38198508 TGGCCTCGAGTGGTCCAGCCTGG + Exonic
1166084383 19:40465499-40465521 GGGCCATGAGCGCCCCAGCCAGG - Intronic
1166371563 19:42304255-42304277 TGGGCAACAGTGGCCCAGCTTGG + Intronic
1166552327 19:43674469-43674491 TGGCCCAGGGTGACCCAGCCAGG - Intergenic
1167357840 19:49014985-49015007 GGGACAGGGGTGGCTCAGCCGGG - Intronic
1167619311 19:50552155-50552177 GGGTCAGTGGTGGCCCAGCCCGG - Intronic
1167620501 19:50557423-50557445 TGGCCCAAAGTGGCACAGCCAGG - Intronic
925026354 2:610258-610280 GGGCCAGGAATACCCCAGCCTGG + Intergenic
925031332 2:652118-652140 CGCCCAGGTGTGGCCCAGCTGGG - Intergenic
925305835 2:2847474-2847496 TGGCCAGGGGTGGCCCTGCAGGG - Intergenic
926019248 2:9480938-9480960 TGGCGAGGAGTGACAAAGCCAGG + Intronic
926442925 2:12909297-12909319 TGGGACGGAGTTGCCCAGCCTGG + Intergenic
926685968 2:15697873-15697895 TGGCCAAGAGTGGCCAGGCGCGG + Intronic
927153955 2:20211295-20211317 TCCCCCAGAGTGGCCCAGCCTGG + Intronic
928096695 2:28409277-28409299 CCATCAGGAGTGGCCCAGCCTGG + Intronic
928117819 2:28560143-28560165 TACCAAGGAGTGGCCCACCCTGG - Intronic
928204183 2:29272394-29272416 TGGACAGGATTTTCCCAGCCTGG + Intronic
929198049 2:39206462-39206484 TGGACAGGAGCGGCCCGGCTAGG + Intronic
929435353 2:41924702-41924724 AGGCCAGGAGAGGCCAACCCAGG - Intergenic
930117522 2:47731188-47731210 TGGCCAGGCTTGGCCAGGCCAGG + Intronic
931234667 2:60403178-60403200 TGGGGAGGAGCTGCCCAGCCAGG - Intergenic
931377008 2:61717017-61717039 GGACTATGAGTGGCCCAGCCTGG + Intergenic
932493950 2:72137535-72137557 TGGCCAGGAGGGGCCATCCCAGG + Intronic
933955540 2:87358988-87359010 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
934239727 2:90255199-90255221 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
934323825 2:91987745-91987767 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
934750981 2:96793923-96793945 TAGGCTGGAGTGGCCCAGGCTGG - Intronic
934769024 2:96896154-96896176 TGGGCAGGCCTCGCCCAGCCGGG + Intronic
935271396 2:101437225-101437247 AGCCCAGGAGTTGCCCAGCCTGG + Intronic
935605745 2:104970642-104970664 GGGGCAGGAGTGGGCCTGCCTGG - Intergenic
936040367 2:109145209-109145231 TGGTCAGGAAGGACCCAGCCAGG - Intronic
936110498 2:109660641-109660663 TGGCCTGGTGTGGCCCAGGGAGG + Intergenic
936155949 2:110047657-110047679 TGCCGAGGAGGTGCCCAGCCAGG + Intergenic
936188739 2:110323771-110323793 TGCCGAGGAGGTGCCCAGCCAGG - Intergenic
937364172 2:121248949-121248971 TGGCCAGGAGAGGCCAGGCAAGG - Intronic
937418546 2:121736811-121736833 GCGACAGGATTGGCCCAGCCGGG + Exonic
937997476 2:127706121-127706143 TGGACAGGACAGGGCCAGCCAGG + Exonic
940908298 2:159188420-159188442 AGGCCAGGATGGGGCCAGCCTGG + Intronic
945007546 2:205424568-205424590 TGTCCAGGAGTGCACCAGCCAGG + Intronic
945893230 2:215452902-215452924 TGGCCAGGAGTGGCCCACACAGG + Intergenic
946230138 2:218286247-218286269 AGGCCAGGAGTTTGCCAGCCTGG - Intronic
946402122 2:219473652-219473674 AGCCCAGGTCTGGCCCAGCCTGG + Intronic
948196926 2:236103415-236103437 GGGCGGGGAGTGGCCCAGCAGGG - Intronic
948423133 2:237872634-237872656 AGCCCAGGAGTGGTACAGCCTGG - Intronic
948488644 2:238297344-238297366 GGGCCAGGAGTCCCCCAGGCAGG + Intergenic
948624838 2:239262570-239262592 TGGCCAAGAGTGTCAGAGCCAGG - Intronic
948754454 2:240150867-240150889 TGGGCAGGAGTGATGCAGCCTGG - Intergenic
948823354 2:240561265-240561287 TGGCCAGCAGGGGCCAAGGCGGG - Intronic
948879657 2:240850366-240850388 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879672 2:240850410-240850432 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879687 2:240850454-240850476 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879702 2:240850498-240850520 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
1169105172 20:2988342-2988364 TGGCCAGAAGTGGCACACTCTGG - Exonic
1169263764 20:4155448-4155470 TTGCCTGTAGTGGCCCAGCCAGG - Intronic
1170665741 20:18384649-18384671 GGACCAGGAGGGGCCCAGCCTGG - Intronic
1170842905 20:19938518-19938540 TGAAAAGGAGTGGCTCAGCCAGG - Intronic
1171176267 20:23052416-23052438 TAGGAAGGAGTGGCCCACCCTGG - Intergenic
1172603149 20:36197301-36197323 GGGCTAGGAGGGGCCCAGACTGG + Intronic
1173002279 20:39112751-39112773 TGGCCAGTGGTGGCCCTTCCCGG + Intergenic
1175247813 20:57592067-57592089 GGGGAAGGAGTGGGCCAGCCTGG + Intergenic
1175879198 20:62246994-62247016 TGGCCAGGTTAGGCCCTGCCAGG + Intronic
1175904019 20:62371068-62371090 AGCCCAGCAGTGGCCCAGCTGGG - Intergenic
1175933037 20:62502418-62502440 CTGCTAGGGGTGGCCCAGCCAGG + Intergenic
1175957107 20:62617033-62617055 TGGCCAGGAGAGGCACTGCCTGG + Intergenic
1176020127 20:62958553-62958575 GGGGGAGGAGTGGCCCAGGCAGG - Intronic
1176593241 21:8661491-8661513 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1178921705 21:36743184-36743206 TTTCCTGGGGTGGCCCAGCCTGG + Intronic
1179545746 21:42111346-42111368 CAGCCAGGAGAGCCCCAGCCAGG + Exonic
1179725982 21:43341479-43341501 TGGCCAGGAGGGGCTCACGCCGG - Intergenic
1179891178 21:44335774-44335796 TTGCCAGGAGATGCCCAGCCTGG - Exonic
1180079517 21:45480400-45480422 GGGCCAGGAGTAGGCCAGGCGGG + Intronic
1180276087 22:10638618-10638640 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1180550594 22:16533596-16533618 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1180825384 22:18857678-18857700 TGGCCAGGAGGAGGCCAGCATGG + Intronic
1180879096 22:19191322-19191344 TGTCCAGGTGTGGTCCAGCCGGG + Exonic
1181051089 22:20238649-20238671 TCCCCAGGAGCAGCCCAGCCTGG + Intergenic
1181141380 22:20807743-20807765 TGGCCATCATTGGCCCAGACAGG + Intronic
1181187347 22:21116869-21116891 TGGCCAGGAGGAGGCCAGCATGG - Intergenic
1181211851 22:21293624-21293646 TGGCCAGGAGGAGGCCAGCATGG + Intergenic
1181354072 22:22288215-22288237 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1181397649 22:22633262-22633284 TGGCCAGGAGGAGGCCAGCATGG - Intergenic
1181438711 22:22924833-22924855 CCCCCAGGAGTGGCTCAGCCTGG - Intergenic
1181500397 22:23312632-23312654 TGGCCAGGAGGAGGCCAGCGTGG - Intronic
1181631838 22:24155760-24155782 TGGCCAGGAGTGCGGCAGGCCGG - Intronic
1181651756 22:24262796-24262818 TGGCCAGGAGGAGGCCAGCATGG + Intergenic
1181776014 22:25160714-25160736 TGGCCACACCTGGCCCAGCCAGG + Intronic
1181917690 22:26293537-26293559 AGCCCAGGAGTTCCCCAGCCTGG - Intronic
1182096623 22:27630367-27630389 AAGCCACGAGTGGCACAGCCTGG - Intergenic
1182294784 22:29306601-29306623 TGGCCAGGGGAGGTCCACCCGGG + Intronic
1182429412 22:30291135-30291157 TGGCCTGGCCTGGCCCAGCTTGG + Intronic
1183022671 22:35039735-35039757 AGGCCAGGAGGTGGCCAGCCAGG + Intergenic
1183109998 22:35641946-35641968 TGGCCAAGAGAGGCCCAGGTGGG + Intergenic
1183250988 22:36730264-36730286 TGGCCAGGTCTGGCCCTCCCAGG + Intergenic
1183489255 22:38108065-38108087 AGGCCATGTGTGTCCCAGCCTGG + Intronic
1183705504 22:39472907-39472929 TGGCTGGGAGGGGCCCAGGCAGG + Intronic
1183731181 22:39619437-39619459 TGGCCAGGGATGGATCAGCCAGG - Intronic
1183831924 22:40422818-40422840 TGGCCAGGGGTTGCCAAGCCAGG + Intronic
1183894122 22:40954057-40954079 AGGCCAGGAGTTGACCAACCTGG + Intronic
1183984634 22:41562651-41562673 TGGACATGACTGGCTCAGCCAGG - Intronic
1184298206 22:43539610-43539632 AGGCCTGGGGTGGCTCAGCCAGG + Intronic
1184321730 22:43747071-43747093 TACCCAGCATTGGCCCAGCCTGG - Intronic
1184457271 22:44618398-44618420 TGGTCCGGGTTGGCCCAGCCTGG - Intergenic
1184691503 22:46119400-46119422 AGTCCAGGAAGGGCCCAGCCAGG + Intergenic
1184769199 22:46587982-46588004 TGGTCAGGAGGGGCACAGGCGGG + Intronic
1185048116 22:48539233-48539255 AAGACAGGACTGGCCCAGCCAGG + Exonic
1185177051 22:49333880-49333902 TGGGCAGGAGGGACCCCGCCTGG + Intergenic
1203215102 22_KI270731v1_random:1808-1830 TGGCCAGGAGGAGGCCAGCATGG - Intergenic
1203275531 22_KI270734v1_random:83581-83603 TGGCCAGGAGGAGGCCAGCATGG + Intergenic
949302369 3:2599194-2599216 TGCCAAGGAGTGGCCCAGGAGGG - Intronic
950444089 3:13026072-13026094 TGGCCAGCAGCGGCCCTGGCAGG + Intronic
950482663 3:13254306-13254328 TGGCCAGGAGGTGCCCAGGCTGG + Intergenic
950665742 3:14493769-14493791 CGGCCAGGAGTGGCACCGCCAGG + Exonic
953200765 3:40776808-40776830 TGCCCTGCAGAGGCCCAGCCTGG - Intergenic
953714394 3:45305235-45305257 AGGCCAGGAGTTGACCAGCATGG + Intergenic
954305407 3:49722971-49722993 TGGCCAGGAGGGCTCCATCCTGG - Exonic
954620996 3:51995507-51995529 GGGGCAGAGGTGGCCCAGCCTGG - Intronic
954708837 3:52495150-52495172 ATGCCAGGAGGGTCCCAGCCGGG + Intergenic
955860576 3:63325579-63325601 AGGCCAGCAGGGGCCCTGCCAGG - Intronic
960895581 3:122501236-122501258 AGGTCAGGAGTTGACCAGCCTGG - Intronic
964552880 3:157904377-157904399 AGGTCAGGAGTTGACCAGCCTGG + Intergenic
965757455 3:172040404-172040426 TGTCCCGGAGAGGCCCAGCCGGG - Intronic
966885935 3:184378190-184378212 TGGGCAGAAGTGGCCCAGGCAGG - Intronic
968927645 4:3558300-3558322 TAGCCTGGAGTGGCTCATCCTGG - Intergenic
969300224 4:6293138-6293160 TGGGCAGGAGCAGCCCAGCCTGG + Intronic
969457822 4:7310181-7310203 TGCCCAGCGGAGGCCCAGCCAGG - Intronic
970326666 4:14932340-14932362 TGGTAAGGAGCTGCCCAGCCAGG + Intergenic
970492402 4:16587691-16587713 TAGCCAGGAGTGGGACAGCTGGG + Intronic
973222914 4:47749578-47749600 TATCTGGGAGTGGCCCAGCCAGG - Intronic
977043360 4:92040979-92041001 TGGCCATGTGTGGACCAGTCAGG + Intergenic
981454096 4:144933632-144933654 TGGGCAGGTGTGGCCCAGCTGGG + Intergenic
981713715 4:147732704-147732726 GGGCCAGGCGGGGCCCAGGCGGG - Intronic
983646605 4:169997757-169997779 TGGGCAGGAGTCGGCCATCCAGG - Intronic
985272472 4:188207168-188207190 TGGCCAGGAAGGGTCCTGCCTGG + Intergenic
985275545 4:188234144-188234166 TGGCCAGGTGTGGCACTCCCCGG - Intergenic
985667361 5:1188000-1188022 TGGGCAGGGGTGGCCCATACTGG + Intergenic
985710355 5:1424349-1424371 TGGCCAGCAGGGGCAGAGCCTGG - Intronic
985995119 5:3593463-3593485 TCTCCAGGTGGGGCCCAGCCAGG + Intergenic
986675814 5:10184470-10184492 AGGTCAGGAGTAGACCAGCCTGG - Intergenic
986735580 5:10665324-10665346 TGTCCAGGACTGGCCCAGGCAGG - Intergenic
987114446 5:14714859-14714881 GGGCCTGGAGTGCCCCAGCTGGG - Intronic
990035300 5:51311095-51311117 AGGCCAGGAGAAGACCAGCCTGG - Intergenic
990048758 5:51468782-51468804 TGGCCAGGCATGGCCAAGTCAGG - Intergenic
994848823 5:105026194-105026216 AGGCCAGGAGTTTACCAGCCTGG + Intergenic
997469194 5:134107343-134107365 TGGCCAGCCATGGCCCGGCCGGG - Intergenic
997635097 5:135398976-135398998 TGCCCGGGAGCGGCCCGGCCTGG - Intronic
997689824 5:135820916-135820938 AAGTCAGGAGTGACCCAGCCGGG - Intergenic
997883492 5:137611349-137611371 TGGACAGGAGTCCCCCAGGCTGG + Intergenic
998521733 5:142807335-142807357 TTGCCAGAAGGGGCCAAGCCAGG + Intronic
999754406 5:154653659-154653681 TGACCAGGGGTGGCCCAGCTTGG + Intergenic
1001296385 5:170502096-170502118 TTGCCTGAAGTTGCCCAGCCAGG - Intronic
1001413087 5:171524496-171524518 AGAACAGGAGAGGCCCAGCCTGG + Intergenic
1001506448 5:172283935-172283957 AGGCCAGGGCTGGCCCATCCCGG + Exonic
1001686846 5:173599740-173599762 AGGCCAGCAGTGGACCAGCATGG + Intergenic
1002058956 5:176615142-176615164 TGGTCATGAGAGCCCCAGCCTGG + Intergenic
1002461478 5:179375972-179375994 TGGGGAGGAGGAGCCCAGCCAGG + Intergenic
1002661085 5:180791600-180791622 TGGCAAGGAGGGGCCCAGGAAGG + Exonic
1005249228 6:23925799-23925821 TGGCTTGAAGTTGCCCAGCCTGG + Intergenic
1006742724 6:36320881-36320903 TGGACAGGAGTGGTCCTGGCTGG + Intronic
1007448783 6:41927408-41927430 GGACGAGGAGTGGCCCACCCTGG + Exonic
1007727187 6:43923696-43923718 GGTCTGGGAGTGGCCCAGCCAGG + Intergenic
1007778458 6:44237414-44237436 TGGGCTGGAGGGGTCCAGCCCGG - Intergenic
1007782905 6:44264468-44264490 GGGGCAAGAGTGCCCCAGCCTGG + Intronic
1009430025 6:63555901-63555923 AGGCCAGGAGTTCGCCAGCCTGG - Intronic
1009881256 6:69569081-69569103 TGAACAGGAGTGGCCTAGCATGG + Intergenic
1011017348 6:82771603-82771625 TGGCCATGAGAGCCCAAGCCTGG + Intergenic
1011329129 6:86184196-86184218 TGGCCAGGAGTGTTCTTGCCTGG + Intergenic
1013705907 6:112833612-112833634 TTGTCAGGACTGGCCCTGCCTGG + Intergenic
1013804626 6:113983574-113983596 AGGTCAGGAGTTGGCCAGCCTGG + Intronic
1014272470 6:119349545-119349567 TGGGCAGGAGGGGCGCAGCGTGG + Exonic
1018724309 6:166598944-166598966 TGCCCAGGCAGGGCCCAGCCCGG + Intronic
1018798703 6:167206693-167206715 AGGCCTGGACTGTCCCAGCCAGG + Intergenic
1019505259 7:1387325-1387347 TGGCGAGGAGGGTCCCAGCGTGG + Intergenic
1019575037 7:1733565-1733587 AGGCAGGGAGTGGCCCAGCCCGG - Intronic
1019638671 7:2090654-2090676 TGAGCAGGACTGGCCCAGGCAGG + Intronic
1022648753 7:32255818-32255840 TGGTCAGGAGTGGCAGAGGCTGG + Intronic
1023062163 7:36338503-36338525 AGGCCAGGAATTGACCAGCCTGG - Intronic
1023875420 7:44283895-44283917 TGGCCTGGTGGGGCCCAGGCTGG - Intronic
1025251122 7:57352289-57352311 AGCCAAGGAGTGGCCAAGCCTGG + Intergenic
1025916991 7:65873585-65873607 GGGCCAGGAGCGGCCGAGCGGGG + Intronic
1026036425 7:66833228-66833250 TCTCCAGGGGTGGCCAAGCCAGG + Intergenic
1026037494 7:66840140-66840162 TCTCCAGGGGTGGCCAAGCCAGG + Intergenic
1026983066 7:74537908-74537930 TCTCCAGGGGTGGCCGAGCCAGG - Intronic
1027632372 7:80622305-80622327 TGGCCAAGAGAGGCCCAGGTGGG + Intronic
1027672477 7:81118897-81118919 AAGCCAGGTGTGGCCCAGGCAGG - Intergenic
1028162222 7:87498599-87498621 TGGCAAGGAATGGAACAGCCTGG + Intergenic
1029283644 7:99452095-99452117 TGGCCATGAGTCTCCCAGCTCGG + Intronic
1029288615 7:99484408-99484430 AGGCCAGGACTAGACCAGCCTGG + Intronic
1029403736 7:100360670-100360692 TGGCCAGAGGTGGGCCAGGCTGG + Intronic
1029408279 7:100390928-100390950 TGGCCAGAGGTGGGCCAGGCTGG + Intronic
1029477755 7:100795060-100795082 TGGCCAGGGGTCAGCCAGCCTGG - Intronic
1029582681 7:101447816-101447838 GGGCCAGGCGTGGGCCAGGCTGG + Intronic
1029703449 7:102262712-102262734 GGGCCAGCTGTGCCCCAGCCTGG + Intronic
1031992096 7:128205238-128205260 TGGCCATGTGAGGCCCAGCAGGG + Intergenic
1032020548 7:128405338-128405360 GCCCCAGGAGAGGCCCAGCCAGG - Intronic
1032087285 7:128890875-128890897 TGGCCGGGAGGGGCACCGCCAGG + Intronic
1032087435 7:128891374-128891396 AGGCCAGGAGAGGCCCGCCCAGG - Intronic
1032087743 7:128892642-128892664 TGCCCAGGAGGGGCTCAGCAGGG + Intronic
1033027838 7:137793545-137793567 TGGCCAGGTGAGGCCAAGGCGGG - Intronic
1034436446 7:151064807-151064829 TGGGCAGGAGTGACCAGGCCAGG - Intronic
1034557158 7:151857584-151857606 TGGCAGGGGGTGGCACAGCCGGG - Intronic
1034748524 7:153545601-153545623 TAGCCAGCAGCTGCCCAGCCAGG - Intergenic
1034873749 7:154706473-154706495 TGACTAGGAGTGGCCTGGCCAGG - Intronic
1035600194 8:892738-892760 TGGGTAGGAGAGGCCGAGCCAGG + Intergenic
1036223025 8:6936827-6936849 TTGCCTGGAGTGGGCCTGCCCGG + Exonic
1036226220 8:6960089-6960111 TTGCCTGGAGTGGCTCAGACAGG + Intergenic
1036228258 8:6978562-6978584 TTGCCTGGAGTGGCTCAGCCTGG + Exonic
1036230711 8:6997679-6997701 TTGCCTGGAGTGGCTCAGCCTGG + Exonic
1036233157 8:7016778-7016800 TTGCCTGGAGTGGCTCAGCCTGG + Exonic
1036557958 8:9876503-9876525 GGGCCAGGTGAGCCCCAGCCTGG - Intergenic
1037887152 8:22601150-22601172 TGGCCAGGAGTCGGCCTACCTGG - Exonic
1039211693 8:35223668-35223690 AGGTCAGGAGTTGACCAGCCTGG - Intergenic
1039389925 8:37171391-37171413 AGCTCAGGAGTTGCCCAGCCTGG + Intergenic
1039518007 8:38148971-38148993 TGGTCAGGCCTGGCCCTGCCTGG + Intronic
1039907710 8:41798481-41798503 TGGCCTGGGATGGTCCAGCCTGG - Intronic
1040931955 8:52744669-52744691 AGGTCAGGAGTTGACCAGCCTGG - Intronic
1041237097 8:55814609-55814631 AGGCCAGGAGTTGACCAGCCTGG + Intronic
1044675879 8:94728169-94728191 AGGTCAGGAGTTGACCAGCCTGG - Intronic
1045556421 8:103218830-103218852 TGGCAAGGCCTGGCCCAGTCTGG + Intronic
1046074805 8:109302480-109302502 TGGCCTGGCGAGGCACAGCCTGG - Intronic
1048027814 8:130602717-130602739 TGACCAGCAATGGCCCAGCACGG + Intergenic
1048224002 8:132567430-132567452 TGGGCAGAAATGGCCAAGCCTGG - Intergenic
1048302239 8:133260245-133260267 GGGCCAGGAGGAGCCCAGCCAGG + Intronic
1049214989 8:141403386-141403408 TGGCCAGCCTGGGCCCAGCCAGG - Intronic
1049787914 8:144459972-144459994 TGGCCAGCATGGGCCCAACCAGG + Intronic
1050009723 9:1173126-1173148 GGGGCAGCAGGGGCCCAGCCCGG - Intergenic
1050343221 9:4662008-4662030 TGCCCAGGAGTGTTCCTGCCTGG - Exonic
1053070454 9:35098366-35098388 AGCCCAGGAGTTGACCAGCCTGG - Intergenic
1053692645 9:40594221-40594243 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1054272172 9:63043312-63043334 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1054303887 9:63395139-63395161 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1054402665 9:64721649-64721671 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1054436276 9:65205980-65206002 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1054494117 9:65815707-65815729 AGTCCAGGAGTTGACCAGCCTGG - Intergenic
1054877477 9:70111986-70112008 TGCCCAGCAGTCTCCCAGCCAGG - Intronic
1057559017 9:96112774-96112796 AGGCCAGGAGTTGACAAGCCTGG + Intronic
1057900295 9:98943406-98943428 TGCCCAGGAGTGGACCTGCCTGG - Intronic
1058455616 9:105135425-105135447 AGGTCAGGAGTTGACCAGCCTGG + Intergenic
1058601397 9:106674570-106674592 TGGCCAGGTGTGGTCCAGCCTGG - Intergenic
1060193418 9:121607510-121607532 AGGCCAGGAGTTCGCCAGCCTGG - Intronic
1060556100 9:124507807-124507829 TGGCATGGTCTGGCCCAGCCCGG + Intergenic
1060728854 9:126024696-126024718 TGGGGAGGAGGGGCCCTGCCTGG + Intergenic
1060816271 9:126637004-126637026 TGGTCTGGACTGGCCCAGCCTGG + Intronic
1061008736 9:127942999-127943021 GGGCCAGGAGGGTCCCAGCATGG + Exonic
1061144153 9:128787398-128787420 TGGCCAGGAGTGGCCCAGCCGGG - Intronic
1061308728 9:129748616-129748638 TGGCCAGGTGTGGCCAGGCCAGG + Intronic
1062024002 9:134332177-134332199 TGAGCAGCAGAGGCCCAGCCTGG + Intronic
1062049011 9:134437689-134437711 CGGCCTGGAGTGGCTCTGCCGGG + Intronic
1062054079 9:134461926-134461948 TTGCCAGCTGTGGCCCAGCCAGG + Intergenic
1062147644 9:134998836-134998858 TGCCAAGGAGTGGCCCTGACTGG - Intergenic
1062234898 9:135503089-135503111 AGGGCAGGAGTGGCCAAGCCTGG - Intronic
1062443363 9:136583396-136583418 TGGCCCGGGCTGGCCCAGGCTGG + Intergenic
1062548058 9:137072592-137072614 TGGCCAGCAGTGTCCAGGCCAGG + Intergenic
1062574429 9:137199864-137199886 TGGCTAGGAGTGGCACTGGCAGG + Exonic
1062586860 9:137253408-137253430 TGGACAAGGCTGGCCCAGCCTGG + Exonic
1062623177 9:137431660-137431682 TGACCAGGAGTGACCCAGCTGGG + Intronic
1062624288 9:137435916-137435938 GGCCCAGGAGGGGCCCAGGCTGG - Intronic
1062710394 9:137972173-137972195 AGGCCTGGAGGGGCCCATCCTGG - Intronic
1203531160 Un_GL000213v1:143232-143254 AGGTCAGGAGTTGACCAGCCTGG - Intergenic
1203623283 Un_KI270749v1:140298-140320 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1187269306 X:17765360-17765382 AGGCCAGGAGTGGCCAAGTGGGG - Intergenic
1187429250 X:19206617-19206639 AGGCCAGGCCAGGCCCAGCCTGG - Intergenic
1188841542 X:35023854-35023876 TGTCCAGGAGAGGCACTGCCAGG - Intergenic
1190109776 X:47582482-47582504 GGGCCCGGGGTGGCCCAGCAGGG + Intronic
1190412515 X:50151120-50151142 TGGGCAGGCCTGGCCCAGTCAGG + Intergenic
1191861138 X:65667523-65667545 TGGCCAGGCCCGGCGCAGCCAGG - Intronic
1192436847 X:71148412-71148434 TTGCCAGGAGGGGCCTGGCCCGG + Intronic
1195936066 X:110126794-110126816 CACACAGGAGTGGCCCAGCCAGG - Intronic
1196847964 X:119911726-119911748 AGACAAGGAGTTGCCCAGCCTGG + Intronic
1197373516 X:125654293-125654315 AGGCCAGGAGTTTCCCAGCCTGG - Intergenic
1199976368 X:152897233-152897255 TGGCCAGGAGTTGGCCTACCAGG - Intergenic
1200057362 X:153468694-153468716 TGGCCAGCTGAGACCCAGCCAGG + Intronic
1200112748 X:153750453-153750475 TGTCCAGGAGGGGCTCAGCATGG + Intergenic
1201191212 Y:11442663-11442685 AGTCCAGGAGTTGACCAGCCTGG + Intergenic
1201730142 Y:17193659-17193681 GGGCCTGGCCTGGCCCAGCCTGG + Intergenic
1202203275 Y:22377235-22377257 GGGTCAGGAGTTTCCCAGCCTGG + Intronic