ID: 1061147112

View in Genome Browser
Species Human (GRCh38)
Location 9:128806481-128806503
Sequence CTGCCACTGACCTGGAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1061147106_1061147112 18 Left 1061147106 9:128806440-128806462 CCTGAGCAGATCTGGTTTGGATC 0: 1
1: 0
2: 0
3: 13
4: 107
Right 1061147112 9:128806481-128806503 CTGCCACTGACCTGGAATGTTGG 0: 1
1: 0
2: 1
3: 26
4: 216
1061147102_1061147112 25 Left 1061147102 9:128806433-128806455 CCAGACCCCTGAGCAGATCTGGT 0: 1
1: 0
2: 1
3: 10
4: 151
Right 1061147112 9:128806481-128806503 CTGCCACTGACCTGGAATGTTGG 0: 1
1: 0
2: 1
3: 26
4: 216
1061147105_1061147112 19 Left 1061147105 9:128806439-128806461 CCCTGAGCAGATCTGGTTTGGAT 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1061147112 9:128806481-128806503 CTGCCACTGACCTGGAATGTTGG 0: 1
1: 0
2: 1
3: 26
4: 216
1061147104_1061147112 20 Left 1061147104 9:128806438-128806460 CCCCTGAGCAGATCTGGTTTGGA 0: 1
1: 0
2: 2
3: 12
4: 141
Right 1061147112 9:128806481-128806503 CTGCCACTGACCTGGAATGTTGG 0: 1
1: 0
2: 1
3: 26
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1061147112 Original CRISPR CTGCCACTGACCTGGAATGT TGG Intronic
900768070 1:4518846-4518868 CTGGCACTGACCTGTCCTGTGGG - Intergenic
900979810 1:6039951-6039973 CAGCCCCTGTCCTGGAGTGTGGG - Intronic
901034859 1:6330369-6330391 CTCCCACTGATTTGGAATCTAGG - Intronic
905345973 1:37311476-37311498 CAGCCATTCACCTGCAATGTGGG - Intergenic
906252670 1:44322908-44322930 ATGCCACTAACCTGTAGTGTTGG - Intronic
907660234 1:56385058-56385080 CTGCCTCTGACAAGGAATTTAGG + Intergenic
910465176 1:87491448-87491470 CTGCCACTGGCCCAGAAGGTGGG + Intergenic
914826087 1:151138741-151138763 CTGTCACTGACCTAGAATTTTGG - Intronic
915077354 1:153320132-153320154 CTGAAATTGACCTGGAATGCTGG - Intergenic
918209608 1:182339370-182339392 CTGCCACTAACCTGGCATTAGGG - Intergenic
918224782 1:182471629-182471651 CAGCCACTGGCCTGGTAGGTTGG + Intronic
918240088 1:182613263-182613285 CTACCTGTGACCTGGAAGGTAGG - Intergenic
919515719 1:198520119-198520141 CTGCCACCGACCATGAATGCAGG - Intergenic
922410748 1:225373015-225373037 CTGCCACTAACAGGAAATGTTGG - Intronic
922695630 1:227729559-227729581 ATGCCCCAGACCTGGGATGTGGG + Intronic
922742219 1:228020425-228020447 CTGTCTGTGACCTGGACTGTGGG - Intronic
923515616 1:234695664-234695686 CTGCCACTGACTGGAAAGGTGGG - Intergenic
1064422304 10:15200906-15200928 TTACCACTGACCTGGAATTCAGG - Intergenic
1066316150 10:34248578-34248600 CTGCCACTTAACTTGGATGTTGG - Intronic
1067443790 10:46327899-46327921 CTGCTCCTGCCCTGGTATGTGGG + Intronic
1067760122 10:49038875-49038897 CCTCCACTGTCCTAGAATGTTGG - Intronic
1069428520 10:68311903-68311925 CTGCCACTGTCCAGCATTGTGGG + Intronic
1069532330 10:69228576-69228598 CTGCTACTGGCCTGGAGTGGTGG + Intronic
1069670952 10:70203443-70203465 CTGCCACTGCACTGCAATCTGGG - Intronic
1071843461 10:89497600-89497622 CTGCCTCTCACCTGCTATGTAGG - Intronic
1072624974 10:97105450-97105472 CTGCCACTGACTTGGCAAGGAGG - Intronic
1072736820 10:97884846-97884868 CTACCCCTTACCTGGTATGTTGG + Intronic
1072905927 10:99453640-99453662 CTGACACTTATCTGGAAAGTTGG + Intergenic
1073486990 10:103825616-103825638 CTGTCTCTGACCTGGAATGTTGG - Intronic
1073504066 10:103967937-103967959 CAGCCACTGGCCTGGAGTGGCGG + Intronic
1074512228 10:114125074-114125096 GTGCCACTGACCTCTATTGTTGG - Exonic
1074549020 10:114426181-114426203 CTGCCACTGACCTGAGATCCTGG + Intergenic
1075651918 10:124132808-124132830 CTGACGGTGACCTGGAATCTGGG - Intergenic
1076124745 10:127964985-127965007 CTCCCACTGACATGGTATGAAGG + Intronic
1076188944 10:128469508-128469530 CTGCCACTCACCTGGCCTCTAGG + Intergenic
1076266587 10:129113698-129113720 CTGACACTGACATGTACTGTGGG + Intergenic
1076541049 10:131215032-131215054 CTCCCACTCACCTGCAATCTCGG - Intronic
1076701748 10:132276854-132276876 CTGCATCTGACCTGGACTCTTGG - Intronic
1077460155 11:2705089-2705111 CTGAGACTGTCCTGGAATGGGGG - Intronic
1077469440 11:2750155-2750177 CTGGCGCTGACCTGGACTCTGGG - Intronic
1078441913 11:11375357-11375379 CTGGCAAGGACCTGGAATGCAGG + Intronic
1078512476 11:11995745-11995767 CTGCCACTGACCTGTGAAGTGGG + Intronic
1078579043 11:12524814-12524836 CTGCCTCTGTCCTGGACTGTAGG - Intronic
1078825425 11:14925370-14925392 CTTCCACTGAGCTTGTATGTTGG - Intronic
1081230943 11:40585058-40585080 TTGGCACTGTCCTGGAAAGTAGG + Intronic
1082778961 11:57271329-57271351 CTGCACCTGTCCTGGGATGTGGG - Intergenic
1083053824 11:59800766-59800788 CAGCCACAAACCTGGAAGGTGGG - Intronic
1083709779 11:64540935-64540957 CTGCCACTGTCCTGAAAGGAGGG - Intergenic
1085049057 11:73370565-73370587 TGGCCAGTGCCCTGGAATGTGGG - Intergenic
1085604063 11:77881518-77881540 CTGTCACTGATCAGGTATGTGGG + Intronic
1085751269 11:79163106-79163128 CTCCCAATGAACTGGTATGTGGG - Intronic
1086909851 11:92459501-92459523 CTGACAATAACCTGGAAGGTAGG - Intronic
1087143840 11:94792314-94792336 CTGACACTGACATGGACTGGGGG + Intronic
1087462813 11:98466800-98466822 CTCCCACTGGCCTGGGAAGTGGG + Intergenic
1087533673 11:99416057-99416079 CTGCCACTGAACTTGAAGTTGGG - Intronic
1088811912 11:113397876-113397898 CTGACAGTGACCGGGAAGGTTGG + Intronic
1090073208 11:123561740-123561762 CTGCAGCTGACCTTGAATGGTGG + Intronic
1091692553 12:2606903-2606925 CTGCCAGTGACCTTGAATGCTGG - Intronic
1092815441 12:12308711-12308733 CTGTCACTAAACTGGAAAGTAGG + Intergenic
1093823428 12:23651138-23651160 CTCCCACTGATTTGAAATGTGGG + Intronic
1095317830 12:40787749-40787771 ATGACATTCACCTGGAATGTAGG + Intronic
1095969652 12:47892767-47892789 CTGGCACTTACCTGGATCGTAGG - Intronic
1096220289 12:49824796-49824818 CAGACACTGACCTGGAGGGTTGG - Intronic
1096685833 12:53287806-53287828 CTGCCCCTGATCTAGAGTGTTGG + Intronic
1098606080 12:72391799-72391821 CTGCTACAGACATGGAATGTTGG - Intronic
1100368331 12:93942240-93942262 CTGCCAAGGCCCTGGAATTTAGG - Intergenic
1102611667 12:114117733-114117755 CTGCCACCTACCAGGAAGGTAGG - Intergenic
1103255676 12:119539670-119539692 CTGCCACTCCCCTGGAAAGGGGG - Intronic
1104713929 12:131004553-131004575 AGGCCACTGAACTGGAATTTGGG + Intronic
1108967497 13:56328122-56328144 ATTCCACTGAGCTAGAATGTTGG - Intergenic
1110787155 13:79542917-79542939 ACGCCACTGCACTGGAATGTGGG - Intronic
1111931164 13:94514544-94514566 CTGACACTGCCCTGGAGTCTGGG - Intergenic
1114397014 14:22373146-22373168 CTGCAACTGACCTAGGATTTGGG + Intergenic
1115740567 14:36383153-36383175 CTGCCTCTCTCCTGGAATGGCGG + Intergenic
1119616484 14:76102171-76102193 CAACCAGTGACCTGGAATCTGGG + Intergenic
1120381534 14:83786458-83786480 ATGCCATTGGCCTGGAATGGTGG - Intergenic
1120381811 14:83790123-83790145 ATGCCATTGGCCTGGAATGGTGG + Intergenic
1125151509 15:36537718-36537740 CTGCCAGTGGTCTGGAATCTAGG + Intergenic
1125212462 15:37233226-37233248 CTGTCTTTGACCTGGGATGTTGG - Intergenic
1127954181 15:63838237-63838259 CTGCCACTGCCCAAGACTGTAGG - Intergenic
1129523557 15:76200436-76200458 CTGCCACTGGCCTGCCATGGGGG - Intronic
1131130881 15:89899534-89899556 CTGCCACTCACCCAGAATCTGGG + Exonic
1131544147 15:93301848-93301870 CTGGCACTGACCTGGAATCCAGG - Intergenic
1132616728 16:844709-844731 CCGCCTCTGACCTGGGCTGTGGG + Intergenic
1133808055 16:9140192-9140214 CTTCCACTGATCTGGATTGCAGG + Intergenic
1134746605 16:16593634-16593656 CTGCAAATGTCCTGGAATATTGG + Intergenic
1134998869 16:18760046-18760068 CTGCAAATGTCCTGGAATATTGG - Intergenic
1136429302 16:30187570-30187592 CTGCCACTCACCTGGCAGGATGG + Intronic
1138416230 16:56872869-56872891 CTGCCGCTGACCTGGGAGGCAGG + Intronic
1139251018 16:65496506-65496528 ATGGCACTGACCTGGAAAGATGG + Intergenic
1139595860 16:67957950-67957972 CTGCGGCTGACCTGGATGGTGGG - Exonic
1140511138 16:75509294-75509316 GTGCCACTGCACTGGAACGTGGG + Intergenic
1140856971 16:78986591-78986613 CCGCCAGTGACCTGGAATTAAGG - Intronic
1141691513 16:85599429-85599451 CTGCCCCCAATCTGGAATGTGGG + Intergenic
1141754686 16:85983320-85983342 CAACCATTGACCTGGAAGGTGGG + Intergenic
1141873977 16:86808961-86808983 CCGCCACTGACCTGGCAGGAGGG + Intergenic
1143765634 17:9135780-9135802 CTTCCAATGCCCTGGAATGCTGG - Intronic
1145980566 17:29008780-29008802 CAGCCACTGAGCTAGATTGTGGG - Intronic
1146257327 17:31399071-31399093 CTGCCTCAGCCCTGGAGTGTAGG + Intronic
1147611955 17:41807103-41807125 CTGCCACTGACAAGGAAGGCAGG + Intronic
1147816305 17:43213219-43213241 TTGCCACTGCCCTGGCAGGTGGG - Exonic
1148948905 17:51291413-51291435 CTGCTACTGACTTGGAATATCGG - Intronic
1149514145 17:57267294-57267316 CTGCTACTGACTTGGAACATAGG - Intronic
1152477857 17:80529874-80529896 ATGCCACTGTCCTGCAGTGTGGG + Intergenic
1153170082 18:2306155-2306177 CTAACACTGACCTTGGATGTAGG - Intergenic
1154160354 18:11976831-11976853 CTGCCACTGCCCTGGCTTCTTGG + Intergenic
1156401641 18:36745137-36745159 CTGCCACAGCCCTGGCTTGTGGG + Intronic
1158440077 18:57467770-57467792 TTGGCACTGCCCTGGAATGTCGG - Intronic
1158697817 18:59718329-59718351 GACCCACTGATCTGGAATGTTGG - Intergenic
1160002747 18:75042789-75042811 CTGCCACTGACGTGACATGCTGG - Intronic
1161354862 19:3813386-3813408 GTGCCACTGATTAGGAATGTAGG - Intronic
1161496809 19:4591050-4591072 CTGCCCCTGCCCTGCAATGATGG + Intergenic
1161544256 19:4870343-4870365 CTCCCACTGACCTTGAATCTTGG - Intergenic
1161790655 19:6357964-6357986 CTGCCTCTGACGTGGGATGGCGG - Intergenic
1162921856 19:13907745-13907767 CTACAACTGTCCTGTAATGTAGG - Intronic
1164437519 19:28244203-28244225 CTGCCATTGATCTGGGTTGTTGG - Intergenic
1164523676 19:28998118-28998140 GTGCCACTGGCCAGGACTGTAGG - Intergenic
1165097224 19:33416265-33416287 CTGCCACTGCCATGGCATGTCGG - Intronic
1165347470 19:35257898-35257920 CTGGGCCTGACCTGGAATGTGGG + Intronic
1167291280 19:48626341-48626363 CTGCCACTGCCCGGGGATGGGGG + Exonic
925821912 2:7807197-7807219 CTGCCACTGACCTGACAGGAAGG + Intergenic
926048830 2:9730123-9730145 GTGCCACAGAACTGGAATGGCGG - Intergenic
928341599 2:30447528-30447550 CGGCCACTGGCCTGGCATTTGGG + Intronic
928411240 2:31055739-31055761 CTCCCACTGCCCTGGAAGGCAGG - Intronic
929246587 2:39709301-39709323 TTGGCAGTGATCTGGAATGTGGG + Intronic
929994381 2:46816320-46816342 AGGCCACTGACCTGGAGGGTGGG + Intergenic
930438720 2:51379544-51379566 TTGCCACTTACCTGGAACATGGG - Intergenic
931427821 2:62187097-62187119 CTACCACTTAATTGGAATGTTGG - Intergenic
934613092 2:95755100-95755122 ATGACACGGACCCGGAATGTGGG - Intergenic
936815043 2:116450169-116450191 CTGCCTCTGCCTTGTAATGTTGG - Intergenic
937970671 2:127546459-127546481 GTGCCACTGAACTGGAGTATGGG - Intronic
940420816 2:153477951-153477973 CTGCTACTTACTTGGAATGCGGG - Exonic
940481490 2:154238012-154238034 CAGCCAAGGACCAGGAATGTTGG + Intronic
941231609 2:162917363-162917385 CTGTTACTGTCCTAGAATGTGGG - Intergenic
943655924 2:190508935-190508957 CTACCACTTACCTTGAATGAAGG - Exonic
947119287 2:226799316-226799338 CTGCGACTGAGCTGGTATTTGGG - Exonic
948208402 2:236174954-236174976 CTGCCACTGGCCAAGAAGGTCGG + Intergenic
948276503 2:236713181-236713203 CGGCCACTGTTCTGCAATGTGGG - Intergenic
949058660 2:241943773-241943795 CTGGCAGAGACCTGGAAGGTGGG - Intergenic
1168805009 20:667324-667346 CAGCCACTGAGCTGGAATCCTGG - Intronic
1173432145 20:42997914-42997936 CTTCCACTGAGCTGGAAGGCTGG + Intronic
1173853976 20:46237879-46237901 CTGTCACTGACTTGCTATGTAGG + Intronic
1174422259 20:50407087-50407109 ATGCCACTGAGCTGAAATGAAGG - Intergenic
1176099637 20:63359091-63359113 CACCCACAGATCTGGAATGTGGG - Intronic
1176962350 21:15173679-15173701 CTTCCACTTTCCTGGAAAGTTGG + Intergenic
1179527249 21:41989305-41989327 CTACCACTGGTATGGAATGTTGG + Exonic
1179797959 21:43796581-43796603 TTGCCACTGGCCTGGGAAGTCGG + Intronic
1184130800 22:42515414-42515436 CTGCCTCTGACCTGGATTATGGG - Intronic
1184140981 22:42577244-42577266 CTGCCCCTGACCTGGATTATGGG - Intergenic
1184847836 22:47100043-47100065 CTGCCTTTGACCTGCAATCTTGG - Intronic
950104314 3:10378618-10378640 CTGCCTCAGACCTGGAATCTGGG + Intronic
951304574 3:21042799-21042821 CTACCACTGAGCTGGGAAGTTGG + Intergenic
952211816 3:31235665-31235687 CTGCAACAGCCCTGGAAAGTAGG + Intergenic
952217577 3:31293063-31293085 CTGTGATTTACCTGGAATGTAGG - Intergenic
952859363 3:37800089-37800111 CTGTCACTTCCCCGGAATGTGGG - Intronic
954212359 3:49104994-49105016 TTGCCACGGACCTGGAAGGAAGG + Exonic
954858400 3:53666399-53666421 CTGCCAATGGCACGGAATGTAGG + Exonic
958438446 3:94126381-94126403 CTCCCACTGGCCAGGAATGTGGG + Exonic
964903797 3:161693447-161693469 CTGTCACTGAAGTGGAATATTGG + Intergenic
965611241 3:170546244-170546266 TTTCCAGTGACCTGGAAAGTAGG + Intronic
966620011 3:181953260-181953282 ATGCCACTGCCCTGTATTGTTGG - Intergenic
967085898 3:186094942-186094964 CAGCCACAGAGCTGGCATGTTGG + Intronic
967319646 3:188183108-188183130 CTGCTTCTGACCTGCAGTGTTGG + Intronic
969781270 4:9406133-9406155 CTGCCAGTTCCCTGGAGTGTAGG - Intergenic
970922372 4:21410315-21410337 CTTCCCCTCCCCTGGAATGTAGG + Intronic
971279436 4:25230360-25230382 CTCCCACCCACCAGGAATGTTGG - Intronic
975838744 4:78452262-78452284 CTGCCACTGACCAGGACAGTGGG + Intronic
977417578 4:96753524-96753546 CTTTCATGGACCTGGAATGTTGG - Intergenic
979038686 4:115759123-115759145 CTGCCCCCCACCAGGAATGTCGG + Intergenic
981224768 4:142280824-142280846 CTGACATTTACTTGGAATGTTGG + Intronic
982346505 4:154366283-154366305 TTGCCACTGACCAGGACTCTGGG - Exonic
986732653 5:10646891-10646913 CAGCCACTGCCCTGGCCTGTTGG - Intronic
989170954 5:38469920-38469942 CTGCCTCTGGCCTGGAAGCTGGG + Intergenic
989450168 5:41577488-41577510 CAGGCACTGATCTGGAAGGTGGG + Intergenic
991254756 5:64601681-64601703 CTGCCAGTGTCCTAGAATGTAGG - Intronic
995019552 5:107351820-107351842 CTGCCACTGGCCTAGGATGGTGG - Intergenic
996019771 5:118578262-118578284 CTGGCACTCACTTGGAATGTAGG + Intergenic
996900793 5:128538986-128539008 CGGCCCCTGACCTGGGATGGGGG + Intronic
997627175 5:135339044-135339066 CAGCCCCTGACCTGGCCTGTGGG + Intronic
998318155 5:141202653-141202675 CTGCCACTGACCTCTAGTCTGGG - Exonic
998796710 5:145827799-145827821 CTGCCAGTGTCCTGCAGTGTAGG - Intronic
999304046 5:150508408-150508430 CTGCTTCTGATCTGGAATGAAGG - Intronic
999436489 5:151567468-151567490 CTGCCACTGACCGGGATCATGGG - Exonic
1001397575 5:171428195-171428217 CTGGCACAGACCTGGCATGCTGG + Intronic
1001753574 5:174149586-174149608 ATGGCACTGACCAGGAATGATGG + Intronic
1003911302 6:10746593-10746615 CTACCAGTGACCAGGACTGTAGG + Intergenic
1004109172 6:12698331-12698353 ATGCCTCTGACTTGGAAAGTTGG - Intergenic
1006031271 6:31178266-31178288 ATGCCACTCACCAGGAATATAGG - Intronic
1007514125 6:42397848-42397870 GTGCCACTGCTCTGTAATGTTGG - Intronic
1007589412 6:43012423-43012445 CTGGTTCTGGCCTGGAATGTAGG + Exonic
1007765610 6:44158154-44158176 CTGCCTCTGCACTGGAAAGTGGG - Intergenic
1010684504 6:78837380-78837402 CTGGCACTGACCTGGAAGCTGGG + Intergenic
1010721123 6:79284057-79284079 CTGGCCCTGAGGTGGAATGTGGG + Intergenic
1013106750 6:107032317-107032339 CTGCCATTTAAGTGGAATGTGGG + Intronic
1015623399 6:135156196-135156218 CTGAAATTGACCTGGAATGTTGG - Intergenic
1017915686 6:158829998-158830020 CTGCCATTGACCCTGAGTGTTGG + Intergenic
1019104147 6:169655291-169655313 CTGCCATCGACCTGCCATGTGGG + Intronic
1019777463 7:2921143-2921165 CTGGCACGGCCCTGGAATGTGGG - Intronic
1021229954 7:18074393-18074415 CTGACACTGGCCTTGCATGTTGG + Intergenic
1023029482 7:36079842-36079864 CTGTCACTGTCTGGGAATGTGGG + Intronic
1027779372 7:82503508-82503530 CTGACACTGTCCAGGAAGGTGGG - Intergenic
1028181534 7:87730428-87730450 TTGCCACAGACCTGGGATGGTGG + Intronic
1030218080 7:107067070-107067092 CTGCCAGTGATGTGGAAGGTCGG + Intronic
1030476764 7:110043877-110043899 CTGCCACTGCTAAGGAATGTGGG + Intergenic
1031002459 7:116432661-116432683 CTGCCACTCATCTTGAATCTTGG - Intronic
1031260122 7:119507475-119507497 TTGCCACAGACCTGGGATGGTGG + Intergenic
1031553513 7:123143583-123143605 CTGCCACTGCCAGGGAATGAGGG + Intronic
1032319073 7:130868309-130868331 CTGGCACTGCCCTGGTATGTGGG - Intergenic
1032455192 7:132067870-132067892 CTGCCACTCACTAGGTATGTGGG - Intergenic
1033842070 7:145386858-145386880 CTGCCCCTCTCCTGGCATGTAGG + Intergenic
1036278700 8:7380050-7380072 CTGCCAGTTCCCTGGAGTGTAGG - Intronic
1036342823 8:7931818-7931840 CTGCCAGTTCCCTGGAGTGTAGG + Intronic
1036838163 8:12092573-12092595 CTGCCAGTTCCCTGGAGTGTAGG + Intergenic
1036859953 8:12338821-12338843 CTGCCAGTTCCCTGGAGTGTAGG + Intergenic
1038065627 8:23960873-23960895 CTGACACTTACATGGAATGAAGG - Intergenic
1039821423 8:41138623-41138645 TTGCCACTCTCCTGGAGTGTGGG + Intergenic
1040711296 8:50192241-50192263 ATTCCACTGGCCTGGGATGTTGG + Intronic
1041490406 8:58426692-58426714 CTGTCACGGAGCCGGAATGTGGG - Intronic
1043129398 8:76442168-76442190 CTGAGATTGACCTGGGATGTTGG - Intergenic
1045116092 8:98982100-98982122 CTGCCTCTGGCCTGGGATCTAGG - Intergenic
1045158352 8:99505767-99505789 CTGCCACAGACCTTCAATTTGGG + Intronic
1045956176 8:107910565-107910587 CTGCCACTTAACTGAACTGTTGG - Intronic
1046436878 8:114202158-114202180 CTGCCACTAAGCTAGAATGTTGG + Intergenic
1047288033 8:123505275-123505297 CTGGCCCTGACCTTGAATTTGGG - Intronic
1048783950 8:138030728-138030750 CTACTACAAACCTGGAATGTAGG + Intergenic
1049219963 8:141424668-141424690 CTGCCAGTTACCGTGAATGTAGG + Intronic
1050168920 9:2795455-2795477 CTGGTTCTGACCAGGAATGTGGG - Intronic
1050895282 9:10879042-10879064 CTGCCACTGACTGGGATTTTGGG + Intergenic
1054959269 9:70949342-70949364 GTGCCACTGACCAGGCATGGTGG - Intronic
1056685860 9:88758765-88758787 CTGCCCCTGCCCTGGAAGGTGGG + Intergenic
1058391406 9:104499324-104499346 AAGCCACTTACCTGGAGTGTTGG - Intergenic
1061147112 9:128806481-128806503 CTGCCACTGACCTGGAATGTTGG + Intronic
1062511813 9:136910394-136910416 CTGCCACAGCCGTGAAATGTGGG + Intronic
1185574715 X:1162285-1162307 CTGGCATTGACCTGAAATCTCGG - Intergenic
1187271143 X:17780863-17780885 CTGGCAATGACCTGGAATGCAGG - Intergenic
1187363799 X:18650538-18650560 GTGCCTCGGACCTGGAGTGTCGG - Exonic
1188492241 X:30749898-30749920 GTGCCACTGCCCTACAATGTGGG - Intergenic
1189317315 X:40065193-40065215 CTCCCTCTGGCCTGGACTGTAGG - Intronic
1190106838 X:47567065-47567087 CTGCTGGTGACTTGGAATGTGGG - Exonic
1191210766 X:57882706-57882728 CTGCCTATTATCTGGAATGTTGG - Intergenic
1193742230 X:85231576-85231598 CTGCCACTGCCCTGGCATGGAGG - Intergenic
1195763669 X:108274079-108274101 CTCTCACTGTCCTGAAATGTAGG + Intronic
1201342167 Y:12946528-12946550 CTGGGACTGGCCTGGACTGTGGG + Intergenic
1202037749 Y:20651597-20651619 GTGCCACTGGCCAGGCATGTAGG + Intergenic